Description :
From Genome Similarity Track
Location :
Scaffold_71:13864- 17096
Transcript NameFunction/comments
Phyci_29846Amino Acid/Auxin Permease (AAAP) Family
Phyci_315129amino acid/auxin permease-like protein

Sequence
3232 bases(100 bases per row)
CCAACCCAACGGACTCGACCATGGCTCGCAGCGCTGtcttcacgatggaggacgccaaggcggccttcaacctcttctgctgcgtctacggcattggaac
gcttggtatgcccggcaacttctcgcgtgccggacctgtgatcgcggtcttcgccatggccttcatggccttcgccaacacgtactcctcggtggccatt
tgccgtgtcatgctgctcgctcctcgttcggtcaagacctacggcgacctcggcgagtggtgcatgggcaagaccggccgctacctgtcggtcgtctcgc
agatggccaactgcctgctcgtgccctgcgtcttcttggtgctgggcggaacactgctggacggcctcttcccggaagctttcagtggatcgacgtggat
catcctcatggcgctcatggtgctgccggtgtgcctggtgccgactctcaaggaaggagccggcgctgccttcgcaggctgcatgggcactctcattgcg
gacattatcggcgtctccgtcgtcatgtacggcatgcgcggtcacccgagcgtgccgtcgcccgacctcaacttcaagcaggttgctggcgctttcggca
acctggccctcgcgtacggtgccggcatcgtgatcccggcgctgcagcgccagcacagcgaccccacgcgcatgccccgcgtggtcggtgtgaccattgc
gttcatctcgtgctgcttcctggttttggccagcacggcttactcggcggtcgggtgccagatttcgggcaacctgctgtggtcgatctacccggattcg
gagaccggcctgaccaccctgggcttcgcctcggactggggtgccgtcgtcctcgcctacctattcatgcagctgcacatcacgatcgccttctccgtca
ttctcaaccccgccttctacattgccgagcgcattgtgcttggcatgcacaagTCTCCCGTTGCCGACGTCGAGAACAACCTGATGAGCTATGCCGATGC
TGCCACCCCCGCTGATGGCGCTGAGCGGTCGGAGAAGGAGTCCCGTGCTTCCAAGCGTTCGTTCATTTCTGTTGCTGACAACGAGAACGTGCACCTTGGT
GAGCCTgaggcggaagctgctgagtaccgtggagccaacgctctcaagtacgtgattcttcgtattgtgatcatcattatcctggtgattgcatcggtgc
ttctgaaggaccacttctcggacctgtcagactttgtcggcgcgtcgtgcatcacggtgaactcgattcttctgcccattgtcttcctcttgaagaagaa
gtggactgtacttccaatgtgggagaagattccagcgctggcggtgatcgtggtgtgcttctgcctcggctgctacgtgacgtacacgtcgggcaagaac
ttgttcgcccccagcgacgatgacgcggcattcccgttctgcgctccggagtatgagaacactgtgtactacaactacacGGCCGAGCACGAGAACTAAA
CATTAGCGTAGTAGTTCTACCTCAAGGCGTTGCATCTACTAAGGCGTTTAGCACACTTACCTCTGCACGTGAAGTTCAATGTNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAATTCAAAAGTGAACC
GATTTCTTAACAACCGCCGCAAAGTTTCACAGCGCAACTGACACATACTTATTCAGCCTAGCTCTCGTGCTCGGCCgtgtagttgtagtacacagtgttc
tcatactccggagcgcagaacgggaatgccgcgtcatcgtcgctgggggcgaacaagttcttgcccgacgtgtacgtcacgtaacagccgaggcagaagc
acaccacgatcaccgtaagcgctggagccttctcccacatcggaaggacagtccacttcttcttcaagaggaagacaatgggcaggatgattgagtttac
cgtgatgcacgacgcgcccgcaaagtccgccaagtcatggaagtggtccttaaggatcacggacgcgatcaccaggatcgtgataataatgacgcggaga
atgacgtatttgattgcattcgcgccccggtactcggcagcctccgcctcCGGGTCGCCGAGGTGCACGTTCTCGTTGTCAGCAACAGAAATGAACGAGC
GGCGCTTTGAGGCGCGCGACGTGTGCGACTGCTTCTCGGAGCGCTCGGCGACATCAGCCGGCGTGGACACATCGGCGTAGTTCAGCAGGTTGTTCTCGAC
GTCGGCAGCGGGAGActtgtgcatgccaagcacaatgcgctcggcaatgtagaaggcggggttgaggatgacggagaaggcaatcgtgatgtgcagctgc
atgaagaggtaggcgaggacgacgataccccagtccgaggcgaagcccagggtggtcaggccggtctccgagtccgggtagatggcgtacaggagattgc
ccgagatctggcatccgatcgctgagtacgcggtgctagccaggatgagaaacaacaccgagatgaaggtcatggtgactcctacgacgcgaggcatgcg
cgtggggtcgctgtgctggcgttgcagcgccgggatcacgatgccggcaccgtacgcgagggccaggttgccgaaggcgccagcaacctgcttgaagttg
aggtcgggcttcgggatacttgggtgaccacgcatgccgtgcatgacaacagcaacgccgatgacatcggtgatgatggtgcccatgcaaccggcgaagg
cagcgccagctccttccttaagagtcggcaccaggcacacgggcatacatgagagcgccatgaggatgatccacgtcgtcgtgctgaaagcttccgggaa
gaggccgtccagcagtgttccgcccagcaccaggaagacgcagggcacgagaaggcagttggccatctgcgagacgaccgacaggtagcggccggtcttg
cccatgcaccattcgccgaggtcgccgtaggttttgacggacgtgggcgcgagcagcatgacgcggcagatagccacagcgccgtagacgttggcgaagg
ccatgaaggccatggcgataatcgcgatgaaggggccggcgcgcgaaaagttgccaggcataccaagcgttccaatgccgtagacgcagcagaagaggtt
gaaggccgccttggcgtcctctgcggtgaaga