Description :
From Genome Similarity Track
Location :
Scaffold_41:138629- 146086
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14722dynein heavy chain

Sequence
7457 bases(100 bases per row)
CAGCAGGGAAAACATCGGACGGGTACGTAGTGCACCACAGTCGGAAATCTGGGTGTGTGTTGTCGAGCTTGATATCTTCAGCGATCTTCTCCATCACAGG
CATCCAACTTGGCGCTAAGTGGCAATTCTGCAACACAACCCACGAACCAGCTTCACGAGCACGTACGATCATCCGTTCAGCAATGGGACCTTGACCTTGA
CCAAGTGAAATCGTCTCTGCCTTCTGTCGAAGTGAGTCTGCAAACTTAAGCACTGAGCTGATCGGATCGGATCCTGGAGACAAGATAAACACCAAAGGCG
ACGACACGCTACTGTCCGAGTAAGAGAGCGCCAAATCGAATTGAGGAGGCTTGACGAACTTTTCACCCATTTCTTTGACTAAGAACTGCTGGATTCCAAC
GACGAGAAGGTCAGGACGGATACATCGTAGACCCAGGAGTCGACGAAACTCACTAACTTTCCCCAACACACCAGGGAAAAGAAGGGTATGACCGACAGGG
CTATCGTACACAGCCTTCCATTGGTCTTCGTTATCGATGAAGTCCTCGATGATGCCTTGGAAAGCAGGTAGAGCGCTCAGTCGTGAGAATTCTGCCCACT
GTTTGTCACTCAGCCAAAGCTTTGCTGGATTTGGAGGCGGTTCCGAGAGAGCTACACCTCCAGTGAGCAAGAAATACCATTCACTGCTCTCAATGTCGTG
CTTCCCTTGTTTGATGGAGATACACAGCAGGAAGGAGAACATGAGCTTATCTTTCTCCAACAAGGAGCGGCAGATATTGCGATAAAGTGAGTAAGTGAAA
TGAGCGTCAAGGTTGAGCAGACGCTGAGTGAGATCTGGTGATCGATCGCTGTTCTGAATGCTGGCGATGAACAAGTTGATGAACCAGGAGAGCGAGTACT
GATAGACTGGCTCAATGTTCGCAAGTTGGTCGATGCAGAAGAATAACACTTGACTTGAATAAGCCACAGGTTTGTAGCCTTGTCTAACTGTATCGATCTC
CAATTCGGTCTTTTCGGCAACTTGTTGCTCTTTTTTGATCTCATCTGCGACTTGTTTACTCTGGTTCATTGTGTTGATGGCATCTTCGTCCTCGAGAATA
TTTCCTTGTGATGACGACAAAATGTTCAAAATCTTGTCTTCAATTTCCTTGAGTAGTCCCTTGTTTCGTGCATTCTGAACAATCAATTTGTTCTTCTGTT
CTTCCAGATCTGGTCGCTCTTGAGCAACGACGATACCCAAAAGTTGATCTTCCAGACCATGTGGTGTGATCATAAAGTTTAAAAGCGTCACCTTCACCGA
CACCTCTGGCAAATAGTGTGGGTTACGATACTTGGTCGTAATGTAGAAACGGAAACTTTCGGCGTATTCAACAGTCGAATCACCCAGTCGGATACATGTC
ACCCCACCCTGCTTGAACGTCTGCTTTAGTAGCAATGGCTCGAGTGATGGATCAAGTTCTTCACCGACATTTTCCAGTAATACTGGAGTGCCAAACTGTA
CCGAATTTTCGAGCGTTCGCATGTAGTCGGTATCTGTGAGTTTAATCACCGTCATTTGGTTATCTTTCTCCATGTTACGAATCCACTTATTGGCTTGGCC
CTGTGGATCAATCATTAGAGGCCATCGACGTGAATTGAAGACGATGATACCGTTATCAACAGAGAAGCCGTCAGTCGGGAGTCCGTCGATATTCCACTTT
CGAATTTGAACAGCGTCACCAAGTGACCCATTGAGAGATGGGAAATCGCTGCAAGGAATATCAAGCTGCTTGCAACGTGCCACCCAGTCGTGCACGGCAT
CGTGTCGGTATAACGACGTAAACGGCCCGAGATACGCCACCACTCCGGCCGATACCAGCACGTCTCCTGTCAATCTGCTGTATTGAACCGCTAGCTGTTC
CGCAAACTCTGTCCAACGGGTCTTCTCACCTCCAAGACTTTCAATCAACGTCGACGCTCGGACGAGCTTTTTACCTGTAAGATCCACCTGGTACTCAAGA
TTTTCCTTTTGCTTAGTCGCAAAGTCAAATTGCCGCTGCAATTCTGCTAAACCGTCCTCCACTTGTTTCAACTGGGACAATTTTTCGTTAAGCTTTTGCA
TCACTTCGGCGAGTTGTGCTTCGGCTACTCTTAGTGCCTCACGTTTAGGTGCAACAACCTTGGAGACGTTATCATACAAAGCCATCGCGTGGACCCATTT
ACACAGCCCTGCGGCTGCTTTCGAGGCCTTCTCTGCCTTTTCTGGACTAAAATTCTCGTCAGCGATATACTTACTGACAACAATTTTCATGGTTTTAGGA
TCAAGATTGTCCTTGTCGAATTTCTTGAGCGTCGTGATAAAAGTCGGGTCACTCAGCATTTTCTGTGAAGGACCCCAGTAGTCCATGATACGCTTTGACG
GGTCTTGTGGGTCTGGAATACGAGCTGGTTTAATGCCAAGCATGACGCAGACACCTTCACACACGAGCTTCACGCCTGCAGGCGGGTTACTCATTGCTTT
TACTTCGTTGATCTCACTTGGTTTGATAGTATCCAGAGCCTTTAGAGCCTCTTCCAATGCTGGAATGGCTTCCGCTAAATCTGCCTCGACACTAGCCTTC
TGCTGTTCACACTCCGCTTTAGAAGCGTCAGCCACCGCAACGTCAGCTTGGACTTCACTACGTTGTACTTCGACTCCAGGGAGCTTCGCTTTGATCTCCT
CCATCAGAATATCTGTGTCTTTCTTCGACTGATCAAGTACTGGCTGCAAGTCTTCCAACTCTTTCCGCATCACCGCCACATTGTTTTCTGCAAAGTTGAT
CTTCTCCAAACCAACAACGTACCGATTACGTGCGCCTTGTACAGCTTCGCGTCGACGTGCAAGGAAACCCTTGAACGCCACGATAAGCTCAAGATACGAC
GTTGGTGTCACGTAGTTCTGACGCCGCAGATTCTTCAAGAATTTATCTGAAAGCTCCATCACGCTCACGTGGAAATATTGACAAGTGTCTACAATGGCTT
TGCGGACATTTGCGCTATCCATTTCGACATCAGCTAAGAATTTCTCAGCCACAGCCACGAGAGCATCAGACGGCCACGCAGTGAACCAGTCAATGGTACA
GCAGTTAATAAGTGAAGGGAACTTCCGCAGTCGGTCTCTAAAGGCATCGCCGATAGGGGAACACGCCAGTACAATGTGCAAGTTACTACGCACGCGCTGT
AGGAAAAACGCGTACAGTTGTGTTTGATTCATATTGTCCCCCACTGCTTTGCCGAATTTTTCCTTGACGTGCGGACGGACAGCTTCACATATACCCACAC
GCTCATCGTACGGGAACAAATTCGGGATTTCTCCTGAATTTAACATGTTATTGATATCCTCCACGAATCCATCGTATTTGATCTGGGTATCACTGAACAA
GAACACCAGCGGTCTTGCACCAGTGCCAGCCATACGTAAGACATCTTTCATGTCTTCGCGCCACTCGATCATCGTATAATTCTTCGAGATCTCGATCTGC
TTGATCTCAAAGTCGACAATAAACGCAGACAACCGCGTAAGACTTTGCCGTCCACTGCCACCCACACCGACAAGAAGTGCGTTACCACCAGGCATGTTGA
GTACGCGAACAATACGGGACAAATGCTCAATGGCGAACAAGAACATGACCAGATTCATTGGCTTTCGACTGACTCCATTGTACTCCGTCAAGTACCCATC
AAGACATTGAATGAGTTGTGCAATACCGTCAAAATCAGAGTCCAGACGAACGTCCACTTCCTTGTAGAGTCTCGGACTTGCATCAGGATCAATATAGTCC
CCAAAGAAGAGATTTCGCATGTCAACAGCTGTAACGGGGCCTTCTCGACCGCGTTTGAGACTTGCGAAAACTTTGTCGAAATTTGTTGCAAAGTGTTTAA
TGGTGATTTTCTTCTGAACTTCATTGAACCACTCGCGATCCTCATCGTCGATCAAACGGTCACCGATCACTCGAAGCGATTCGTGCACCCACAGCTTCAC
TAAGCTATTGGCATTAAACTGGTCGTTTGGTACTACCAGCATAATTCCTTGGACGATTCGAGAGAAATCTCGTAGATTGAATGTATAATGAGACTTCTTA
GGAGTGGGAAGGAGCGACATCATGGCGGATTGATACAGCTCGAGAGTGGCAGAAACCACGGCTTCTGAGAGTCGTTTAACCTCCGGAATAAATGGATTCG
AACCAAAGTACCAGTCCAGAATCGTGGTGAAGATACGAGTTAGTGTAGCATCATCAAATTCAGAAATACACAGCAGATTGAAGTGGCGAAGCAAGCGAGG
GGTGACGTTATTCCTTCCACCACCTGGTGGTCCCATAGCCGCAAGTACAATAGTGTCGACAATCTTACGCCAGGACATTTCCTTGAGATCGTAGTATCCC
TCGCTATCGATAAGTTGTCGGACCAATTCGATCGGTGGTTGAGCACCATACGTTTCCACCAGCGGCATGTTGAGATCATCGACGAAAACGATAGCGTTCT
TGCCTAATGGTGGACCGAACACTCCCTTACGGCGTTTATCGAGCTTACCGTCAATGATATTCTGCGTCATATTAGCTGACGTTTTTGCCGAGAATGACAG
CATGATGACTGAATTTTGGTCTTGTGGTAGTACCTCACTCAAAATCGAGGTCATATAACAAGATTTTCCTGTTCCTGTTGGACCACAAACTAATACTTTC
CTCTTGTTCGTCACAAGAAGCTGCACTAGATATTCCAACTGAGCAGTGAAGATTGTAGGTACGACGATCTGATTGAACGGCGTATTGGGCTGGATAACGT
ACGGCTTGAGCATTTCTTCCCACTTGAACCATTTGTTCTCTTCGATGTTAAAGTAGTAGTCATGTAAGTTACCTTTAGCAGGCACTGGAAGTGCTAGAGT
GTACGTATTTTTCCCGTCTTCAAAGGCTGGTTTCTCCCACTTGCGAACTTGAAGTGCTCGACTTACAACGATGTATTTGCTCTCCAGCGACTGAATATTC
TCCATGATAGAGCGTACGAAGTCGCAAAACTTGATTCTACCTTCTGCGCTGATACTCTCACCTACAGACCACGTAAGGGAAAACATGAAGAGCGCTTCAA
TCGCGGCTTTTTTCTTCGACGCTGTGTCTTTCGGAAGCTTACACAGTTGTGCCTCGAAGATGTGGATAAGACTCTGCACCAGGTTCGTATCCACAGTCGG
GGAGAGCTCAACCAGCTCTTTTCGAACAAACGCAATGCAGGGCTCAACAAGCCACGAGAACAGGAAGTAGATGAGGTTTCGCTGCTCGCTGTTGATTTCA
AATGGTCCGAAAGGGGTGTCCTTGCTGCCTTCCACCACTGTGATCGAGTCCAGCCACGAATTGAGCACTGGGATCCAACCTAATTGCTCGGGTTCCATGT
AAATCATACCACAACGAGAAACTGTGGCAGGAGAAGCGACCAGCAAATCCATGGGTTCGAACATCATGCTCATAACTGAACTCATAGCGATAATCTCTCC
ACTCATCAAGCACAATTTGCGGTTATCGTCGAGCACAGTGTTCATGTTTTCAATCCAAACCGCATCAACTGGACCGTCAAACATCAGCCATTTGCGATCC
GGCGAAGGATTATTCGCTAGATTCCGGTAGTTGATGGCAAGTACACCGTCATTCCATTCGTGAGAGACGGCATCGAATTGGCCATACAGCTGTCCCATTG
TCACCGATTTCGGGTTAATCACGGAGACAATAACGTTGGTATAGCGAGAATCATTCGGAAATTTTTGGTGCAAATGGGCTAATACTTCGGACAGCACTCT
CCATGAACACGTCTTGCCTGAGAACGGCATTCCTACGACCATAAATCCGTGACGAACGATCATCATTTCGTAGATTTGAATCACCTTTTCCACAAAGTTA
GGGACGGGTTGTAGGTTCATTTGTTTGCAGACATGGTTGATTGAATTGAGCATGTCCCGTCGATCAGGAGGATCAATCGTTACGCCAGGGAAGAGATCGG
ATACGATACCATTGAATAAAGGCACATCGGGCGACAGGAACTTGGGCAAGTTGACATCAATAATCGATCGCAGAACTAGTGTATCTTCTCGCAAATGGCC
CTCAGCTCGCTTTAAGTTGCCGGCAGCTCGAAGCACAGCCATAACAGCTCTCATTCCGTAGTCATAGTGAGACTGTGAGGACAACTGCTCCGAGCACAGC
GTGTATGTGGTCGTGATCTTCTTGGACAACGCACTTGCGTCCATATACCCGTAAGAATACAGCATAATTTCGGCAATCATCGCATAATCTGGGACCATCA
TCGCCACCGTACGGAACAAAACTTTCAAGTTATCCGGCAGTTCTGCTCGTCCTGCATATCCAGGGTTCATCGTAATGAAAGGACAGCACGTAGGATTAAG
TCGCAGCTCTGTACCTTCAAAAATGAAGGTGGTAAGATGCTGAGCCTTGGCCAATTGAATACAGAGAATCTGTTGAGCAATAACCGAAAGCACCTCCAAT
TGAATACGGTTGAACTCGTCAAAACAGGCCCATGCGCCTGAACTCGCGAGACCTTTGAAAAATTTCCCCATTGCAAGATAATCGAGTCCATCTGAGCAAT
TCGTTACCACGCACTGAATTGCAATCGCTTTTGCAAGATCCTTGGTCGTTTCTGTCTTGCCTGTTCCAGCAGGACCCTCAGGCGCACCTCCAAGATTCAA
GTGAATAGCTCCTGTTAGAGTTCGGTAGCATCTATCTGTAAGCGGGGTGATCACTAAACGCATACTGTTTCCGAGGTATTCGAATGCGTAGAGTGCAAGC
GTGTTGATCATTCGACATTCAAGAGTATGAGGCTTCCCAGTTGTCGCTGAGACTCCGCCTTGGATCCAGTAGTATCGCAATTGGGCAAGCCAATCGAAGT
CCATTTTATCCGTGATTTTCAGATCGACCAGCTCTGCGATTGTATCTCGGTTGTGCACGTCCATGACTACAAGAGCTCCCAGTGTGATGCGAATAAGCTT
CGGTAGTTCGCCACGAACCATTTCAACTGTTCGCTTCAGTTCAGTCCTCAGTACTTCCAAGTGATCATGTAGTGCATTAGGGTCTTTGGCACAACTGTTG
AGTGCTTTTTCGCTGTGTTGCGTCCACATTGTCTGGTTAACAGCCAGCACCACTTGGCCTGGCCATTGTTGCACCCACTCCAAGCGATCTTTTGTCGGAT
AATCCATAATCGATCCGTCTAAATGCAACGCTACACTCTTCTTCATAGTCATCTCAACTTCTTCCAGCCACACTTCGACATTTCCTCCAGAATTGTTCGG
ATTGATAAGATTTTGAGAGATTTTCTCGTACCTGAACGGCACCTTTTCCATCTCGGGACTAAGCATGGCAGTGATATCCAAGTTGGCCTGGAACTCAAGC
TGGGAGATCCCATCAAATGCCTTCTTTAGGTGTGGTTGTACACGTAGCGGGTCCTTC