Description :
From Genome Similarity Track
Location :
Scaffold_1362:1386- 3593
Transcript NameFunction/comments
Phymu_g13166phosphatidylinositol-4-phosphate-5-kinase (PIPK-D6/GPCR-PIPK)

Sequence
2207 bases(100 bases per row)
AATCGGTCCCGGTACGGCTTCGGGGGCATGGCGGAGATCCCGTCCGGGTCTTTGCGGAAGAGAATGGTCTTCATAAAGCGTTCAAGCCGTTTGGACCAGT
TCCACGTCTGTAGCATGTCAATGACTCCTATGTAGTAGAACCCCGGGCCGATCACCACCTCTGCAGCCCGCAGGCATTGCGTGGACTGCTTGACTCGTTC
GGTAGTTTCACTCTCAGACGGTAGCTCCTCCTCCCTGTctcgaggagatcctggTTTCCCAGTGAAGCTGTCGGgtggcaagaagacgctcCCGTCCCTC
GTGAGGATATTGTGGCGGTTTACTAAATAGCTCACCTCGATCACGCCCAAGAGCAACGAGTAGTCCATGACGCCGTGCGCACACAAGAAGTCGCTGTCTC
TCATGAGCTGCGCGAGGAGTTTCCGTCCTGCGTTCTTCCCGAAacgcagcttcatcgtgaGATCCATGTCCTTAAGTACGACGTTAGGCTCGTGCGGGGC
TCCTGCTCGATTCGGACAGACATTTCGACGCAATCTGTCGCCTCCGACTGAATTGGAGCGAGTATTCGAGCCGCCGCACCGGAAACTGAGGTTGCAGTGG
CGACAAGTGGCTTCAGCGCCTTTACGAGGCTTCTGGGCGTTGCGATCGACCCAAGAGCCTTTGATATCGTAGCGTTGGTGGATGGAAATCCCTTGCTGAA
CGTCGAATACGTTCTCCATGACCACGAAATACGTCGGACGGCCGTACAATTCCACGCAGTAGCTACCTAAAAACCGCGTTAGAAAGCTTTCCCCGTTTTG
CTCTTCGATGTATACTGTATACTCGGTCAGGATTCCATGTAGGAAAATACTTTCCGATCGGGTCAGGGATTTGACCACGTAACTGCGATCCGATGAATAG
TATACGAAAGAGCCGCTAGCGCCTTCGCTCACCTTGGGGGTGGTGCACGACTTGAGAGATGAGAGATACGCGTCCTCGTGTATACCGTAAAACCGACGTA
TACGCTGGAATTCAACCGGATGGAACGCTGTGAACCGACATTGGTTCCAGGCTGTGTCTTCAGGGGAGGGCTGGACCATGAACGAGTACTGCGTTGGTCC
ACGGTCGGAATGTTGGTCTGGCTGCTCCACTCGTGAGGCTGAGTGGGGAGAtagtgctggagaaggatACTGTCCCAATGTACTGGTTATCCGGACGGCT
TTGGCGATACCGTGCGTGGTGTAGAacaccagctcgtccagcaacgccagaTTCATCTGCGGAcgaacagcgtcgtcgtcttcatcgtcttcttcctcca
cacTCGAGAGTTTTGCTTCTGTTGCCGTACCATCGACCACAACACCAGGTTTGGATTTCCGTTTCTTGTGTTGAGGACGTTTGTATAGACACCAGAGGAT
GAAAGGCACGCTACCACGATACGAGAGCAGGAACGCAAACAGGCGAGAGAGTCTCCGAGCTTGTGTGGCTGAAGGAGTTAACCAGTACGCGCCATATACC
CCCCATAGCAATGCGGAGTAGGCAATGAGCGTCACAGTCGTCAAGAAACCTTCACGTAGTAAGACCCGGCGGTTGTTCAACGTAGCGGACACTCCACGTC
GGAATCGACCGAAGGAAACCAATGTCACGTACAGGTTGGCAACCATTGAGATTGTGGCTGGGGTCACGATGAAAACCCAAATGCCCGTAGTCGATCCGCT
TGGGTTCTTGTAGCTGATGTGGTCGCTTCGTGCCTGAGTGTCAGCCCCTACCCAACAGAAATTACCAACAGCTACAGGAGATCCAAAGCTGTTGGACACA
CACATGATGATCGCACTGGTGAGAGCTGCCATGTGTGCGATGCCTTGGTACTTGTGACGATTCAGTCGTGGCGACGTGAACGGATTTGTCATCTATTATT
TAATTTTTCAGAAGAATTACCAGAGGTGAATATCCATTCCTCGCGTGAAAATGAACGCATACGTACCAAATAATATAAATCAAGTGCCGTGCAGGTTGTC
CAAGCGCTGGAGCACATAATGAGGTACTCTCTGGCTGTAGATAACTGTAAAATACTAactgtaaaaaaaacattacTCTGAATTAGTAAAATCCGTAATA
GTACGCACCCATCGACACGAGAGGTCACTtccgacgccagcgcctAATCGATTCCACGCCGGCTCCAGTAAGAACGAGATGGCCAAGCAAAACTCACAAA
GTGCCAG