Description :
From Genome Similarity Track
Location :
contig_56:1386- 2532
Transcript NameFunction/comments
g10648.t1hypothetical protein

Sequence
1146 bases(100 bases per row)
AACCCGTTCGAATGCGGCGACTTCGTTTCTTTTTGCCACCAACAGCTCGAGCCAGGGTGACCAGCGATGGCGGAGGATCAGAAGAAACACGATCTCTCAA
CTCTTCCGATTCGCTATCGTCCTCGTCTCCACCCGACGATTCCTCATCTCTTGTATTCTTTTTCGTATTGGAATCATCCGTAGGGTCGTCGTTGTGGCCA
TCCTCATCACCAGAAAATGTATCCATCGCTATGACTTGCGCGATATCACTGCTTGTGGCCATTTCAATGGCATTTTTCGCGACTTCGACTTCACTAGCAG
GGACCAGCACTTCAAGCCCATTAACGTCGATTAGTTCCTCGGAATCACTGTCCTTATCATTTTGGACGCTGAAAGTGAGTGATCGACCCCGGTGCAACCA
CGCACTCTTTTCACTGGCAGTCGCATGCTTCGCGACCTCAAAGAAAATTAGCGCTGGTGCGCGTGCCCGTGTCGTAAAAACAGTCCCTTCTTCTTTTGCA
ATCGTAAGGAGCCGCTGCAGTGGGTCATCGCATGACCCTAGTGGGCAGAAAGCTCCTTCTGGCAACTCGAGTTTTTGCAATTCACGCCTCAATGCGTTCT
TACGTTCATGCGGAGGACAGAACCTTAGTCTTTCTGTCATCGTACACAGCTCTTCGATGAACTGAATCTGCGTGGTGAAGATCCGACGCTCTTCCCCGTC
ATCACGATGAGAATCTTCTGGAAGAGTATTGCTTGGCAGTAGGAAATCTGGAGGAATTGAACAGCCATTAACAGCATCGCAGATTGCACCAAGCGGAATA
GTGGCCTTCGTATCTGTGTGAACGAGGATTAACAGGCGATCGAACAGACACTTGATGATGGCCGTTTGCTCTGTCGAAGCTGGTAGATCCTTGTCCGTTT
CAAAAGACCAATCTCCATGAGAAATCTGCATCTCTACGTTGATCATTAGCAACTTGCACATGCTCATCTTCCGGTACAGGAACTCGGGCACATACAACTC
TGACTGGCCGAAACCCCATCCACAGCTGTCGTCAATTGCTGCGCGGGTTAACCAGTAGATAGCAGTTGCTAAGCGGATATGGAGCTGAGTCGCGTAGCAA
ATCACTCGAAAAAGAAGTGCCGCTTTGACACTGTTGCTTGTCCAGT