Description :
From Genome Similarity Track
Location :
Scaffold_75:138541- 139885
Transcript NameFunction/comments
g12306.t1RAW36668.1 hypothetical protein PC110_g7052 [Phytophthora cactorum

Sequence
1344 bases(100 bases per row)
GACCTCTACGCCCATGAGTCCAGGATCTCCTTCCGTGTTTTCTGCTGGTCTTCGTCTTCGCGATCCAACGCGTCAACCAAAATCCCCGGGAAATTATTCT
CGATGAGCGCCTTCAGCTGCGGCAAATCCGCCTTGGGTGGTGCATACGTGCCGCTGTCGTTGTCAATTACGAGTTTCGGCTCGTCGAACAGATAGTTGTC
AACGCGGAACTCGCCAGCATACCTGTGCACAAACAAAGGTCACACTACAGTAGACACAACAATCATGGCAAATGACTGCCTCGGCAATAGCAAACGTACA
GAACGGAGAACGCAGCACCCGAGTGCAGCATGTGCTTGGACAGCATGTCCTTGAAGAACGCAGCGCCCGTTTCGGAGAAGTACCAGCCATTCTTGGTGAT
CACGTACGTGAAAAGCACGGGCTTCTCCTGGCGCCTTCCGTCGTGAATAAGTCTAAAGAACTCGGCGGGCGACGAAATCGCACCATACTTGGTGTTTTTC
GCGCCGTGTGTGTAGATCACAGCGTGCTGCGTGAGAATCGCCTGGCGCAGCACAGGTGCCTGCGGGAAGTCCGGTGAGAAGATGCGTTGGATCGTCGGGT
AGTCCTTGTTCCACTCGTGGTCCGTCGGCAAGAACTGCGGGATGTTGTGCAGTTGAATGTGGTAAGCCAGCGACTCGATCCTGGCAGCGTTCGACGTCGA
CATGGTCACGAGTCCTGCGGTCACGCTCGAGTGCACCGAGTAGCGGACAGGTCCGACTTCGTGAAACCAATTGATGCGCTCAGGGATGACCGGGTGCGAC
TTGACCTGCAGCCCTCAACACCTGAAGTCAAATTTCACAAGCCCCTCACCAGAATATCATGAAAAAGGTGGCACCAACCTTGACCACAATGGTGCCGGCA
TTTCTCCCATTGAGAGAAATGGACAACTCGAACGTCGACTCGGCACCGTCAGTGTTGGCGGCCATAAATTGGGTCTCTCCCAGCTCGTCGTCGGTGTTCA
CGTCCTTGTCGAGCAGGTACAACTTGCACAGTGAGTCCGGCCGCACGTTCTTAAAGAAGAATTTCTCGTTCCACACAGGCTCCAGCGTCGAGAAGATGGG
GTGCGTCCAGGCCACTTTCTGGCCGTCCACCTCGATCACCGCGTAGCCGTCACTGGAGCTCAATTGGCCCTTCATGAGCGCCGTGACGCCCAAATAGTCC
CCGGCCACGATACCCTGTGAAACGAAGTCATTAGTGTATTTTACCACTTGAGAATGAAAGGAATGAATGCCGTTTTTTTTTATTCCGCACTTTGGCAGAC
ACAATTTCGAGCTCCACGTCAAGTAGGGCGCCCTCAGGCAGGTC