Description :
From Genome Similarity Track
Location :
Scaffold_26:138538- 153268
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009508Similar to def6: Differentially expressed in FDCP 6 homolog (Xenopus laevis)
Pytul_DAOMBR144PYU1_G009507Similar to INPP4B: Type II inositol-3%2C4-bisphosphate 4-phosphatase (Macaca fascicularis)
Pytul_DAOMBR144PYU1_G009506Similar to GOLGA3: Golgin subfamily A member 3 (Homo sapiens)
Pytul_DAOMBR144PYU1_G009505Similar to Gnl2: Nucleolar GTP-binding protein 2 (Mus musculus)
Pytul_DAOMBR144PYU1_G009504Protein of unknown function
Pytul_DAOMBR144PYU1_G009503Similar to Nrd1: Nardilysin (Mus musculus)
Pytul_DAOMBR144PYU1_G009502Similar to Kcnn4: Intermediate conductance calcium-activated potassium channel protein 4 (Mus musculus)
Pytul_DAOMBR144PYU1_G009501Similar to RPS15A: 40S ribosomal protein S15a (Bos taurus)

Sequence
14730 bases(100 bases per row)
GTGTCGGCGAGTGGAAAGTTCGAGGACCAGTTCTATCATGCGCACGAAGGTTCGCGGGCGATGGGCAAACTGAAAAACCGCGCGTACTTGAAGAAAGTGG
AGAAGAGCGACTCGTCCAAGAAGAGCAAGAAGAACGTCAATGTGAACGGAAAAGACGTTGAGCAGTTTTCGGACTCGGATATCATCTACAGCGGGTACTT
GGTCAAGCAGGGCTCGTACTGGAAAACGTGGCGCCGACGGTACTTCATCCTTCGACGCGACACCCCCGTGCTCTCGTATTACGATTCAGCAGAGGAGCTC
ACGAAGCTGGGCGAGATCACGGTCGATGCCACGACGACCGTCAAGCCGACGCCACGCGAAGGGTTCCCGTTCCAATTCGTCGTTGAGCACGAGAAACGAA
AACTCACGCTCGTGGCAGAAGAGGGCAAGCCGTCGACCGATGCGTGGATCTCCCATCTCCTGGCGTGCATCCAGCGACGCGCCAACGAAGCAGCCAATGC
GCGTCAGTCTATGGAAAGAAAATCGATTGGGATGCAGGTGCCACGACTCAGCGAGAATGGGTCTGTGGTGGAAGAGCTGCCGAATTTCCGCAAGGATCCT
CGAGACAACCCGTACAGTGCGCAGATGAAGCGCCACTCGACAGATTCCGTGGCCATTTCCGCGGCGATGCAGGAATCGATCGCAGTGCGTGAAGAGGAAG
CGATGCGCGAGCGCCGATTGCGCCAGTCGAGAGCGACGAACGTGGACGAGATGCCGTCAAGGGAGAAAGCAGCGCACCGTCAGTCGATTGCATCGCAGAA
GTCGCGTCGATTCCGTTCGTTGAGCGCTGGAAGCGTTCTCTCCACGCGCTCGACCGACTACGAACCTATGCGTCCAAGGGACGATTCTGGACTGGGAAAG
TTCTCACGAAACAGCCACGAGGGGTTGTCGTCGATAAAGTATCCTGCCAACGAGCACTCACAGACCCGAGCACCCTGCCTGAGCCTGCCCTCGTTCAAGC
GTGGACCGACTCTTGAATTGGCCGTCTCGGTTGGGAGCAAAGGTACACAAGAGGCTGCGCATATGGTGGTGGTGCTGTCGTCTGTCTTTCCTGGAAAGGA
GCCGCAGGAGATTTCACGCACAGAGATGCAAAGTACGCTGGGCTCGCTGCGTGCTTGTGGAGGTGATTTTTACGCACGAGACTTCAGTGCGTCGCTGTCG
GTGCCTTTGAGCGCCAAGGAGATGCTTCATTTTGAGATTTTCTCGTTCAAGAACCCAGGCACTGAGTCTCTTGCGGATCAAGTCTCGCTGGCGTTTGTGC
GCATTTCACCGGTTGACTTAATGCTGTCGAGAGATTCGACGATCGTGTTGGAGTGCCGTCGATCGGCAACATCGAAGCAGTTATTGTTCTTGCTGCTGGA
GCGTATTGTTCCAAGCGAAAGCATCAACTTGGGACACACGTACACATACGCCAGACGCCACTTTGTTGCCGACATCGTCCCGCTTGAAAAGACAAAACCA
ACGGCAGCCGACAAAATGCCTTTGACGGGTGGTGTCCCAAGCAGTCTTGGTATGAGTTACGGTGAGATGGTTCGCGGTAAATTTGATTCAAAGGATGCCA
ACCACGTGTTTATCACCGAAGAGTTGTCGGCATCATACTGCTCCATTTCCGTGGCTCTCGCGTTCATGCGGCATGTTCAAGCTCGCAATCGATCGCGTAT
CGACGAAGCCCGACTGGTGAAGGCTGCTTTTGAGCAAAAGTATGGACCTGTACCGTCGTCGCCGAGTCATCACAAGTCCCAACAGAGTTATGCCAGTGAA
TATGACAAGTTCCAAGACATGACATCGCAACTCGATCGCTACACACGACTTCGTGACATGTACCGAACGTGCGAAGACTACTGCTGGCACCTACAGGTGA
TGCTCGAAGAAGGTAAGGAGCCTGGTTTGACGGGGTCTCTCAAACGCAGTACGCAGAAGAAAGATTTGCTTACGGAGTTCATGCCAACGAACCTCAATTG
CCACCTCACACGGGCCAAGCGGGTGATTCTCTCCAGCGGTCATCCGTCAGGGGCAATCACTCCTGGTATGGACTCCAGCAGTGGTAAAAGCAGCAGCAGC
AGTGTATCTTCACCGGTCGTTGACGAGCACGTGCACACTGTGGTTACCCATGGGTGCACAGCAGCGCATGTTTTGGGTTTTAAAGAAGGCGGACTGCGAA
GGCTGTTGGCCGCTGCGTCCCAATCACCGAAAGACGAGCTCCTGGAAAAGATTGAGCAGCGTCAGGATGTGGTGCGCTGCCAGATTCTCTCGGTCGCGTC
GGCAGCGTTCCTCACTGTCTTGGGCCTCGCGGTGAACAACAAGTCGCCTGTCCATATGGATCGGCTGAAGCTGATCTGCTCGACGGGTTTTTTGCTCAAC
ATTGAGTCGCTACTGAGTACGATGGGTAATGAAAAGGGCATGCTGGAAGACATGGTCGAGGGCGTGAAATGGCTGAACAGCTCGGTGAGTTTGCGCGTCG
TGGAAGCTGAAGTCGCGTCCAAGTCGTTGCGCGAACAGTATGCGTCTCCGTTGAAGTATGCAAAGTGTATAGAGGTGTTGGCTACCAAGGGATCGGAAGT
TGTCGTCACGTTCTCGTTGCCGTCGGAGATCTTTGCTGGCTTGCCTGTCATCCTGAAACAGGGCGAGGCAGTTAACATCCACGCAGTCATGTTCACTCAA
GGCATCAATGAGATGCAGTCCGTGGCGAACACGGTGCTGGACACGAGCTTGCAGGACGAGATCAACTTTGAGAGCGGCACGACGCTGGAGCGCTACTTCC
GCGTGTATCAGGCGTTTGTGAAGTACAATGCCCGCCATAACGAAGGATCCGTGTACAACGATGCACGCTTGGAAGATCTCGTGCATTTGCAGACACAAAT
CAATATTCTTGTCGAGAAGCTAAACGTAACCATCAAGTCTCACGTCCAGAAAAAGAATGTGAACATCCTGTTGGAGACGAGCGATATCTGCCGACGCCTC
GGCGCGGGCAGAACGACGTGCTGCAAGAGTGGGAAAGACCGCACAGCGATGTCCGTGACGCTGGAAAACTCGCAGATCCTCGTGGACAAGTTCCACGTCA
AGCAGGGTGTGCATCTGTGCACGGCCATGCGTGAACGCGGCGTGCGTCGTGTGAACGTGCTTGCGAACACGGGCAAGGACAAGTACGCATTCAACTCGTT
CCAGCTCAAGTACATCCCCGAGTGCTACAAGCCGCCCACGGCGTCGGCCGATTCCCATGTCGCGTCCTAAGCTCGCAATCACTTGTGTTGCTCTCTTGGA
ACGACATGAGAACTGGTACGATTGGGAGGAGTGTTGCCGCCAGTACGGTAGTAGTCATCTGTTCCACTCGATTGGGTGAGAAGAATGCGTTTGCAGTGCG
TGCTTTGCCTTGCTATTTTCCCAAAAAGAACATGTTCGCTTTTGCATTTTCCCCACTGTGTGTCTCCCCTGATGCGTAGACGTCTTGTACCCTTCTATTC
TAGATATCCCACAGCGGGTCCTGCATCGACTGGAGCTCTTTCTCGCGTTTCCGGCTGCGCTGAAGCTTCTGGACCGCAAAGTGGAGCTTCTTGTCTTTGT
CGTGGTTGCTGGCCTCGAGCGTCTCGACTTGCGCCTCCAGGGCCGCGACGCGCGGGTGGAGGTACACGGCGTCATGCACCTGCTTCTCGAAACTCGCGAT
TTGCTCGCGGTGCTTCACTCGAAGCTCGTGCTGAGCAAAGACGTATCATATATCACAGGAGCAAGCAAGGTGTCAAAGAGGATATGAAGGCGTGAATGGA
GCAGAGGAGACGCTTTACCTGTTGGTGCACGAGTTGGGCCGCGATGGTCTCGCCCAGCGTCGCCACTTCGTCCAGTTGCGTGCGGTACACGTCCACCTGC
TGCAGCAGATGCAGCAGCAGCTCGTCTTTCTCGTCAGAGCCGATCTTCACGAGCGCCGACCGAACACGTGCTGTCCTTTGGCGATCGACAACTTCGCCAG
TATCCTCGTCGTCACTTTCCGTTTCAACAGTATGCATGATTCGTCTTGGTTGCGACTTTCTTGTCGGCTCTTGGGCGTGCTTTGGTCGCCAGAGGTTCTG
CAGTTGCTCAGCAAGCGCCGCAACGGATGGTGGCGTTGCGGTCATCATATTGGTATCATTGGAGTCTCCATGAGCTTCCCATCGTGTGGATTCGGCCTCT
TCTTGCGGGGGTGATGGTGGTGGAGGAAGCAATCGCGACGTGGCCTCGACTGAGGCTTCGCTGCTGCTGGACCTGGCGGAAGGAGACCTCGCGTTTTGAA
GCGCCGCATGGCGCGCCATCGCCTGCTGCAGCCGCGCGATCGAAGAGAGCTGCTGGGACGCATGCTGAGCAAATCAGCACCATCCTGGAGGCCATCTTCA
GACGGAGCCATGAGCGCAAGTGTGGACGCAGCGTACCTGTTTGCTTCTGTGCGAAGCCTCGCCCTCGCGATGCCAGTTCTCCGGTCTTTTCTCCATATTT
TTTGCTCGTTGTCGCGACTTTTTTCCCCCAACATGAAGACTCCAAGAGCCGCTTTTGACAAACTCCATGACCAAACAGACATCTCGTATATAAATTTGAT
TTGGGAATAGAAAATTAGGAAGAATGAGATGAAGAGAGAAACCAAAATCCGACACACAACAATGTGCTCTACGATGCCGGACGCTGCGTCTATAAACTTG
CTGCACGAGGAGAAAGACACGAGAGACAGCGCGTTTACTGCTTCTCTTCGTCTTCGTCGTCGTGCTTCGTTTCCTCTTCGTCGTCGTCTTCCACTTGCTC
CTCCTCATCGTCGTCCACGGTTTCTTCGTCGTCCTCGTCGACTTCTTCGGCCTCATCTTCGACGTCCGCGGCTTCGTTCAGCGGCGTGTCGTCGGCCGCT
TGCTCCGCGATCTCCTCGGGCTTCATCGGCGGCGCCACGAACCACGGGATCTTGCCGCGCTGATAGTCGTTGATCATCTGCACGGCGACGTTGTTGAAGT
CCGGCTCACCCTTCTGCAACAGCTTGCCGCACTTGATCGCCATCTGCTCGAGGAAATCCCACTCGTCCTTCCAGCTCTCAATGTGATACACCTTGGTCAG
GTACTCCTTCTTGACGCGGTCCAAGATCGCAGGGATAAAATCCGTCGGCTGGGGCAGCTTCTCGGCACGCACGACGCCCTTGAGCACAGTCTCGACTTCG
TCGTCGCCCTGGTCGTACACGATACCTGGGCAATCGATGAGGAAAATGCGGCGCATGAGCGTGATGTACTGCCATACCTTGGTCTCGCCTGGAATCGGCG
CGACCTTGCACACGCGCTTCTTGCGCAGCGCATTGATCACGGAACTCTTGCCGACGTTCGGGTACCCAATAAGACCGACCGAGATCTGCTTTTTGTCTTG
GTGCAGCTTGGCGAACTGACGCAGCAGGTTGATCAACGCTCCCTTGCCGAACGGGTTGTTCATACTCGCGTGGAACGCAAGCGTCGGCGTCGTCTCGCTC
AGCTTCTGCACCCACTTCTTCGTCACCCAATTCGGCACGAGGTCGCACTTGTTGATCACGAAGATCAGGTGCTTGTGCGCCGCATTCTTCTTGATGTGCT
TCTCGACGTGCTCACAGCGCGTGCCCGGCACGTTACGCGCATCCAGCACCTGGATAACCACATCGGAACAATCCAGCACCTTGTACAGTTCACCCCAAAT
ACGTTTCGATTGGCCCTTGTTGAATACATCGTGGGACACTTCGACCTTGAAGTCCTGCTCGACGTGGATGTTGCGATCGCTACCCTTGGCTTCGTAGGAA
TCGGTGGTCGTCTGCACACGACTCAGCAACGACTCGTAGTCGTTCGCAGCGATCTTGGCGCGCTTACGAGTACGCTTACCGTTGAACACGTCTTCGAAGC
TCTCAGTCTCCAGCAACTTCATGCGCGTGACCTTCTCCGAGTCCTGCAGGAGACCCATTGGCAGCTTGCGCGAGCGCAGCACCACCGAGTACGGGTCCGC
CGCCTTCAGCGACATCTCGTTGCGGAATTTGTCGAGTTCCTTCTGACCGACGACACGCGTGTTGCCAAACCACCGACGGTCGGGCTGCACGCGCGCCGAG
CCCGACGTGATCTCCTGGCCGCCCTGCTTGTTGCCCATCATGAGCGACCCGCCCACGATCTTGCCCTTCTTGTTGCGGATGGCGCCACTGTTGCGGTACA
TGTTGAGGCGGTTGATCGTGGCCTTGTCACGCATGTTGGCGGCCTTCTGGCGCTTGGGCACCTGCCGGTTTGGGTTGTCGGCACTCGCCTTCTTCGTGTT
GATTCCCTTCGCCATGGTGCTCTACTGTAGAGAGAGAGAGACGCTCTGTATGTGTGTGTGTGTCTATGCGCGTGAGAGCAGTACGCTGCGGCGGCGGAAG
ATGTTGGCGGTGGGGCGCGTGCAGAAGCCGAAGCGAGCGGAAGCTGTCGGGCGTCGTCCACTGCTTTTCTCGTCGTGCGCCAAAGAGCTCTTCGCTGCGG
TCGGGTATCAAGCAGACACACTGAATGGACTGGCGCTAAATGGTTGGTGGGTGCCAAAATCGCAGCATTTCAGCCAATCTGAATGTAGACAGTGATATGT
CGCATTCATTCTAACCAATCAGTGGCCATGCACTTATACTATTTACAGTAGTGAGCAGATTCACATCCATAAACTACAATTTTTAAACATGAATCAGATA
AAAGGTTTCAACTTCGTAGATTCAATGTCTCCGTTTACTTCCGACCAATGTTACCACCGTTTTTTTATTTTGTTATCATTTTCCCACAAGAGAAAAGCCG
AGCAGCAGCAACAGCAGGAAGATGGCGGCGCGCACGACGACGACGTCGATCGTGGCGGCCACGCCCGCGAACCGTGCGCACCTGGAGTCGTTCCAGTTCG
AGAAGCACGTCACGCATCAGGACGGCATGGCCGGTACGCTCTCCATCCGCCTCGTGGAGGCCCGCAACCTGCGCGCCGCGTCGTCCATGTTCTTCGTGCG
CACGTGTAACCCGTACGTGATCTTCCGCATCGGCAAGATGAACGTGCGCAGCTCCACGATCGTGGCGAACGACAACCCGTCATGGGGGCGCCGCGAGAAA
CTCGAGATGAAGATCCCAAAGCTCGACCACAAGCGCTCGCCGCTGGACGACCACTCGGATATCCGCATGGAGCTCATCGTGGACGCCATGAACGAGGACT
CGCTCACGGGCAAGACCACCGAGTATGTCGGCATGCAAAATGGATCGGTGATCGGCACGGCTGTTGTGGACTTCACGGCGCTGCTCGAGGGCAAGGAAGA
AGTCATGGACCGCTGGATCACGCTCACGGGCGGCATCCCCGTCGTCAATCCAAGCGACAACGTCACCAGCGGTAAGAAACCGAAACGCGCTCCGGAGAAG
GCCATGGATTTAGGTGAAGTGCGTATCATTCTCCACTACGAGCCCCATGGCATGGAGCCGCAGGTCGGTGATGTCGTGAAACTGGAAGGCTTTGGCGCGT
ACCCGTCGGCGCTGCTGGCGCCTGTGGACGAGTTGGAACTGCACGTGAAGAAGATCAGCGGCAACTATTTGCTGTGCAGCTACTTGACCAAGTCGGGCTT
CGAAGGTGCCATGCGGCTGCACCGCAACAATGTGTTTGTGGCGCACCGCAACAGTCTGCTGGATCGACTCTACGTGTCGTGCATCGCGGAGCCCTTTGAG
TTTGTGCGCAACACGCCCATCGGTCAGTCTGCGGGCGAAGTGCTCAAGCCGTACATGAACGTCGCGAGGACGTTCAGCTTCCCGGCACTCAAGGCCGCCA
AGGCAACGGTCATCACGACCTTCCGCGCGTCCACCGCGGCGCTTGGCGCTGTTGTCGCGTCCATGGAGTAGGCATGCGTATGTATGTATCGAGCTTCTAA
TCTATAAAAAATGTATCGTCATTTTTTTCTTTGCTTTGCATTGAACTCGACATTGTATCTTTTAGAGGCGTGTTCTTCTCGCACGCTTTTCATCCAATTG
TACCGACCTATTTTTATTTTTGTCCAATCACAGAAGAGACAAGGTGACGAGGGCGGAAGAACAACGACCACATGCGACAGAGTGACGATGATGACGGGTC
AGTGATTGGCATCAAAGCGTGGAAGACGCGGGGCGGAGGAGAGTCCGCTGTCTGGGCCTTCGACTGCGAATCAATGCTCATTTAGAGTCTGGAGTGCCAC
AGTGCACGTCTCCTTATAGTATCGTGAAGCTTCTGGTGCCTTTGCTTCCTCTCGAATGGCGTCTGTGACGGCGCCGCTGTCACTCGACGAATTCCGGTCG
CCGAGCGACAAGAAACGCTATCGCGTCGTCACCCTCGCGAACGGGCTCGAAGCGCTGCTCGTGCAGAACGAACCGCCCAATGGTAATGACAATGTCCACG
ACGGCGACGCGGAGCCCGACCCGGAGCCCGTGGCGGTGGCGGTGAGCACGCGAGCGCGGCGCCACAGCTTCTTCAGTCCGCCCGACGAAGGCGAGGACGT
GGAGCATGAAGGTGACGACGACGGCGACGACGACGGAGACGACAAGCCGTCGACCTCGCTTCACGCGGCCGCGTGCATGACCGTCGGCGTGGGCAGCATG
GCCGATCCGTCGGACCTGCGCGGCCTCGCGCACTACTTGGAGCACATGCTGTTCATGGGCAGCGACAAGTACCCGGACGAAAACGAGTTCGAGGCGTTCC
TGAGCACCCACGGCGGCTACTCGAACGGCGCAACCGAGTGCGAATCCACGCGGTACGTCTTCGAGATCGGGCCGAGGCACCTGCGGCACGCGCTCGACAT
GTTTGCGCAGTTCTTCATCGCGCCGCTCTTCAAGCAGGACGCCATGGAGCGCGAGCTGCTGGCCATCGAGTCCGAGTTCAACCGCGCGCTGCAGAATGAC
TACGTGCGGCTGCAGCAGATCCAGTGCGAGACGTGCGTCCCCGACCACGCGTACGACACATTCAGCTGGGGCAACATGCAGAGTCTGCAAACAATCCCGA
GCGAGAAGCAAGTCGACGTGCGCGAGCGCATGATCGAGTTCTACCGCACCAAGTACTCAGCCAACGTCATGAAGCTCTGCGTGTACGGCCAAGATTCGCT
CGACGACATGGAGCAGTGGGTGGTCGCGTCCTTTGGCAAAATCCCGCGCGTCGCCAATGTGAACTCTGTGACGTTGTACGACGCCGTGCCTCGACCGTTT
GGCGCGGCCGCGGGACAGAAGCCGATGCTGATCAAGATCCTGCCCGTGCGCAAGATGCACGCGATGCACTTGTACTGGCCGCTGCCGCCGCTGCTGCATA
GCTACAGACAGAAGCCCTGGGAGTACCTCTCACACGTGCTCGGGCACGAGGGCGACGGATCGCTGACTGCAATCCTGAAACGCAAGCGTTGGGCCACGTA
CGTCTCGGCGGGTATCTCCGAGAGCGACGGGTACGAGTTTGGCTCTTTCGGCAGTCTTTTTGAAGTCGCGATCTCGCTCACGCGGACAGGACTCGAGCGC
TGGGACGACGTCGTACAGATTGTGTTTGACGTGTTGCATTTCACAAAGCAGCAGCAGCATGGAGGCGCCCTGGAGTCGTGGATCTTTGACGAGCTCAAGG
CGTCGGCGGAGATGACGTTCCTATTCCAAGAAGAGAAAGAGCCGCTCATGGTGTGCCGGCGCATGAGCGACCTGATGCAAGACCGCCGCGGCGTCGATCG
ACGCGATCTGCTCCGGTACGACACCATGCAGGGTACCTTTGACGAGACGCAGACGCGAGCGCTTTTGGACGAGATGACGCCGTTGAACACGCGCGTGCTG
CTGCTTTCGCACGCGTTTGCGGAAGATTTGCAGTTGGCGTCAAGCCTTGTGGCTGAGCGATGGTTTGGAGCCAAGTACGCGTCGTCGGAGATCGCATCTG
GTATTCTGGAAAGATGGAGAGCGCCTTCTGAGTGCCTGAAAGAGCTCAAGCACCCGTCGCCGAACAGATTCCTGCCACAGCGCTTTGACGTGATTCCGCG
TGCTGAGAGCTCTAGTTCTAGCGGCGTGGAGTGTGGAGACAACTGTGGAGGAGTCCCTGCGCTGGTGCACTCGACGCCGATGAGCAAGCTCTGGTTCAAG
CAGGACGACACGTTCTTCATCCCCAAGACCAACGCGAACTTCCTCATCTGCCTCCCGTCGATCACGAAGTGCGTACGCAACTACGTCTACGCCAAGATCT
ACATGCGGTTCGTGAACGACGCGCTCAAGCACGTCTTGTACCAGGCCAACAACGCGAACCTGGAGTTTGACGTTGGCATTCGCGACCTCGACGTCGAAGT
CACGTTCAGCGGCTTCAGCGATAAACTGCGCGATCTCGTGCGCGAGGTCTTCGACGTGCTGCTGTCAGCTACGATGTCCCCTTTGGTGTTCTCCATTATC
AAAGACGAGCTCGTGCGCGAATACCGCAACCTCAACCTCAAGCCGTCCACGAAGGCGCGGTATCTGCGTCTCCAGCTGCTCGAGCGCATCACGTTTCCCG
TCGAGGACAAGATCCGCGTGCTCTCGGAGGTGCAACTGGACGACGTGGTTGCGTTCAAGGAGTCTGTGCTCTGGAACTGCGACGTCACGCTTCGCAGCCT
CGTGCACGGGAACATCACGCGCGCCGACGCCATCGCGCTTCAAACGGAGATCGAAGCCGCGCTACAGGACGTCGCGCTGCGCTTTGCGCCGCCACTGTCG
CCACTGCGGCCGCATACGACGGCGTTGCCCGTGACTGCGAATGGGCTCCTGTTGCGCGCCGTGAGCGACCACGACGAAGAGACCAACTCGGCGGTCGAAG
TGTACTACCAGGTGGGCAAGTGCTCGTACGAGGACCACGCGTACGCGGAGTTGCTGCACCAGATCATGCAGGAGCCGCTCTTCCACGCCCTGCGCACGCG
GCAGCAGCTCGGGTACGAGGTGTCCTGCTGCGTGCGGGACACGCACGGCGTGCTGGGCTTCAGCATCGCCGTGCAGTCGGCGTCCCACGCGGCGGGCGAG
ATCGCCGTGTGCATCGACCGCTTCGTGCAGCACGACTTTTGCGCGCACCTGGACGCGCTGCGTGGCGACGAGTTCGCGCACCACGTGGCGACGCTGCAGC
GGCTCAAGTCGCGGCTCGACACGACGCTCACGGACGAGACCGATCGGCACTGGGAGGAGATCCAGACACGGCGCTACGACTTCCACGTCGAGCGCGAATT
GGTGGACGCGCTCTCGCAGTGCTGTCTCGAAGGGCTGCGCGAGCGGTACCGCGCGTGGCTCCTGGCCTCGTCCGCCGACGACGAGGACGCCGCTGCGGGG
CCCAGTGAAGGCGGCGGTGCGCGGAAGCTGCGCGTGCACGTTGTCGGGAAGAGCAGTCAGTTCGTGCCGCTCGAGACGCTCGTGACCGAAGACGAAGCGC
CCGAGATCATCGACAACCTGCGCGAGTACAAGAAGGCGCTGCGGTGCCACTGCTAAAGAGCATATTAAACAAACTATGACATAAACGTGAAACGAGCAAG
GACGCAGGGGAGCCCAGCAGAGAAAGGAGTCTGTCTTAAATATGCGCGTTGGGTGATTGTATGCGAGTGCTTCCTTCGTAAGGATGGAGACGAATGCTGT
GTGTGGTTACTCAAAATTGGTCACATCGCTCTGGAACTCGTCCAGGTCTCTCTGTGTGAGAAAATTGCGGATCGACGGCCGCCGCTGGTCGACCAACGTG
CGGCGGCTCAGGCGCTGCAGCAGCGACGCGGCCCCACTGCCATTGCCGGCAGTGCTCACAGCAGCGCTGCTGCTACTACTGTCCATGACGATGGCGGACG
CGCTGGTGGTGCCCGTCGCGCTTGCGCAGAACGAGTCGCGCTTGAGCAGACTGGAGCGCGACACCGACCGCGTGATCTCGTGGAACGCGTCTTGCACGTT
AAGCTTCTTCTCGATGCTCGCGACGCGGACCTCGATCGCGCCGATGTGGTCGTGCACGCGAGCCTTGACCGCGTCCACCTCACTCGACACGTGGCCGACC
TGGACCAGGATTGCCTGTAGCATGGCCTCGAGCGCGAGCGCCCACTCGGGCGGCACCTCCTCCGACTCGGACTGCAGCAGGTTGCGGTCGCTCTCTCGCT
GGAGCATCGTCAGGTGGTGGGGATACGCTTGGGCTTTCTCCGGTGACGCTGCTGCTGCTGGTGATACTGATGACACTGATGCTATGGACGACGCTGCTGC
TCCGTTACTGTTGCTGGGCTGCAGCGTCGCCGAGTGGCTGTTGTGCGTCGGCGACGTCCGGCCGCTGCTGTGGTTGAGCGCGTCGAGCGCGGCCACCGAG
CTCACGACGGAGCCTGACCAAGAAGCCGCGGTTTGCGCGGTCTTGCTTGCGAGCTCCTGCTGCTGGTGCTGGGCCATGAGCGTCGCGGTCGCGAGGCTGC
TGAGCTTGCACTTGCTGTGCCGGTCGGTCTGGCTGTGGAAGAGCTCCGAGAGGTCCTCGATCTTGGTGCGGATGTACTCGACGTTGACCTCCATCATCTC
GAGCATCGTCATCTGTTTGTCCATCGGGTCGCTCACGTCGTGCGAGTTGACGTGGCGCTTGACGTCGCGGTAGGCCTGCAGCACGCTGAAGAGCTTTCTC
TCGCTTTTGCGGATCGCCGCGTGCCCGCGCTTCGAGTTGAGACTGTGATGGTGCTTGCGCTGCGTGCCGATGAGCTGCACGAACGCCTGGATGGACCGCG
CTGCGTGGTCGTTGAGCAGCCGCCGGTTGTCACCCTTCTTAAGGAACGTGTTCACCTTGTGCTCCGACCGTGTGAGCACGAGCTGGTTGCTCATCACGGC
GATGGTCACGGCCGTCAACAGCGTGCCGAACAAGCCCGTGAGCACGGTGACGAAGCGGCCGGGCGCCGTGCGCGGCACGATGTCGCCGTGCCCGATCGTC
AGGATCGTCATCGCGAGCGCCCAGATCGCGTCGGCGAACGCCATGGGCTCGCAGCACGAGTCGCCCACGAACGCGCACAGAAAGCGCTCGACCACGTACA
GCGCGTAGCCCGCGACGCTCAGCAGCAGCGTCACGCCCGCGAGGATGCACCGGCTCGGGTGGTTCTTGAGCGTCGCCTTGAGGAAGAACGTGAGCGTGAA
GTCGACGTTCGTGAGCGCGCCGATGAACCAGCCGTTGCTCGAGTTGAACGAGTTCCACGACTGCACCACGCGCAGCAAAAGCGCCACGCGCGCGAACATC
CAGAGGCTCGTCGCGAGCACCAGGTTGGGCCACCGCGGGTCCACGGCTTCGAGCCCTGGGAACGGGTGCACGCTCAGCACGGCCAGCTCCATGAGCAGCC
GCTTGCGCAGTGACGAGCTCAGCAGCGTCGCCTTGGGCGGCACGATATTCTTGATCTTCATCACCTCACACTCGGCCGCGTAGTACAGGTACACATAGTA
GAGCAGGATGGCCGTCGAGAACGAGATGAGCACGCGCAGCGCGTGCAGGATCGTGCGGCCGTTCACGATCGGGATGACGGTCGGAATGGACGCGCGGCAC
TGCGGACACTGCTGTGTGTAGCTGGTGCTCATGCTGGTCGGACAGGGCGTCGCGAGCTCCTCGGTATTGGCGAACCAGAGGTACTCGATCTGCACGATCA
TGAGCGCGAGCCCGAAGAGCGCGTAGAAGAGCTGGAAGTTGGTGTGGCGCTTCTGCGCCGTCACGAGGCGGATGCGGCGCTCCTGCGACGACAGCGCCTC
CGAGTTGGTGAGCGACATGGGCTTGGACGCCTTGGGCTTGCGCGGCACGGGCACGGGCACGGTGCCGCGCGCGGGCCCACTCGACGCGGGCTCGAACGGC
GGCTTGGCGTCCAGCGGCACGATCTCATTGCGCGCCGGCATGCTGGGGACGGGGGCGCAGGTGCGTCCACCGACTGCCTCTGGTCCGTGTATATGGTGAC
GTTCGTGTCGACAGGCCGTCTTCAGCGCGATGCTATTTGGTCTCGGAGCCACAACTGCTTCTCCTGGTGTCGCTGCTCGCTCTCCATGCTGCCGCCTATT
CATAGCAGCGGTCTTGAAGGTTGCTTTTAATAGGGACGCTGGCCCGATATTGTCGGATTTGGAACAGCCACGGAATAACAAAACAAAGCGATAACGAACA
CACACAGGCACAGAACGCGTTTTTTCGTAGAACCCAAAGAGATCACCTTTCCTTTATTTAGTTGTTCTGGTACAGATCCCTAACGTGTTGGTGGTGGTGT
GTGTGTGTGCACATCCGCTCGCTTAGTAGAAGAAACCGATGACCTTGCCACCGGTGTGCTTTCGGCGGGCCTCGTGGTGGTCCATAATGCCGTACGTGGT
GGACACGACAATGTGACCGAACTGGCGCGATGGCAGCAGGTTGTTGATCCACTTCTCGTAGTCGTGGATCTTGACGTCGAAGCGTGGCGAGATGACACCG
CACTTGTTGATGCGGCCCTTCAGTTCGATCACGATCTTGCCGGCACGGTGGTCATCGACGATCTCGAATTCACCAATGTAACCTGAAAATACACCCAGCA
GCCACAAACGCCCATTAGAGACCGTGCATGAGGACGACGACCCAAAACTGTACTATGACGCGACGTACCGTTCTTCTGCATGACCTGGAGGAACTTGACA
ATGACCTTCGACGAAGGACGGACAAGCACCTGGCGCTTGCCACGCTTCTCCGCGTTGTAGATAGTCTTAAGGCAGTCGGCCAACACGCTCATACGCACCA
TTCTGAAGATACACGACAACACACCACGGA