Description :
From Genome Similarity Track
Location :
Scaffold_24:1385158- 1388683
Transcript NameFunction/comments
Phyin_T30-4PITG_12221Putative uncharacterized protein
Phyin_T30-4PITG_12222Putative uncharacterized protein
Phyin_T30-4PITG_12223SWI/SNF-related matrix-associated actin-dependent regulator of chromatin%2C putative

Sequence
3525 bases(100 bases per row)
GGCAAGAGCAGCAGACTGGAAAGTGATGCTGAGACCTCGCCAACAGCTCATACTTCTTTTAAACGGGAACTAGAGCAAGGTATTCCACTGGAAAGTGTAA
AACTACGAGCGTTGGGGCGATTTCCTGGTCTAGACCCAGGTATATTTCGTGAGAAGTCCGACATTATTGATGGTGTATTGCAACAGTTCGACACCCAAGT
TATGAAAGCTGAACGGAAAATCACAGCTGCTGGCTCGAGATCGGCCACTGGGAATACGCTTTCTGTCTTGCACTACGCTTGCAATGCAAAACTATGTCGC
CCGTGTGATGAGGCTGTCCAGGATGAATTCCCATCTCTGACTCCTTCATTTGCTGGGGGTAATATTTTCCTATCGAGTCTCCTGAATCGAATTGTCTGTC
AAGCATTCTACAATCCCTACATTATGGAAGTAGTTGTAGCTCTAGCAAACGGAAGTGGCTCATTGACTTTCTCTAAATACGGTGATGATTCTCCGAACGT
AGGAAACAATACCGAAAGCTCCCACCGTCGACTTTTTGAGGAGGAAATTAACGACGAATTTGTTGGTGGGGCGTTCATGGATGTTTTTCTCAACTACATA
TCAAGAGAAATGCTCGTAATCGGTGTCATGCGATCTACCTGCCTCGAGCTTGACAACCTCCTGCCATTCGTGTACACGTGTCCTCCCTCATCATTAATAA
TGCACTCGAAGGATCGGCTATTCGTTCTCGGCTAAGATTTTATGTACTATATTACAACAAAATTACAGAAAAGAAAGTAAAATTCATCAAGCTTTTTTTG
TCATGAATCAACACTTTCTTAACCCGCTTATCTTCTTCTTGTTGCTGCAGCTCGAGATCCGGGTTTTGGAGCTGGGGCTCGCTTCGCCCCTCCCTTCATA
CTGTCACGTTGAGTCTTTTCTCGACAGAAATTAATGTGGCGCTCTGCAGCTTTGTCGTTAAAGCGGCGGCTGCAATACTCGCACTGGATGAGACTCGGAT
CCGGCGCAGACGGCATCATAGGAGGCAACTCTTTCCCTTCCTTCAATGCCTTCGATACGTCTCGACTGGCCTTCATGGCATTGCGGAACATGTCGCTTTT
TTGCTTCCAGTCCGCAGCGCTTTTCACCTTAATCGGCTGCTCTGTCGCTGATAGAGGCGCCTTCCGAGCTGCACCTTTGTGTTTCGCTTTGGCTTCCTTC
GCTATTTTTTCTGCTTCCGTTCCTTCCAGTCGCTTAGCTGTCATGTTGAACACCTTGCGGTGACCAGAAAAAACCTTTTCGCAAACTTTCTGGTGCTTCT
GAAATGACACGACGTTGAATTTCCGACTACAGTTCGGACACTGCTCCATTTGTTCCGAGCCATCTCCGTACTCGTCCTGAACGTCCGTTAGCAATGAGCC
CAGGTTAGAAAATAAGACGAATATAATAGATAATTTAAGGGTTATGCTTACGAGTTCTTCGGGTAGATTAAACCCCGAATTGATCGGCGCAGGATAGTGG
CTATCTCCGTCATGAGCATTGCCTAGGAGCGTCTTGCGATTGGTAGGAGGAGCTGGAGCTGCTACTTGAGCTGGAGCTCGTCGTGGTGCCACTTGTTGTC
TTGGTGGTGGACTCGGCGTATCTCGATACATGGAGGTGGATGATGGCAAGCGTGCCGAGTGAATCACAGCGCTAGGCGTGTTCGTCTCTACAAACAGTGA
GGCCTGATTCGTTGGTGCACTCCGCGCTTTCCGACGAGACATCTTGGACTTGAGAAGCATCAGTGAATTCTATAGATTTTCTATTCGTTAGTGAAGCAGG
ATACTGAATAAAAAAAAGCTTTCATATTTTACATACCCCCATCTCGTTTTGCGATGCCATCACAGTGTTCTCTCGATACGGATCGGTCCTGAGCTCTCGT
CGACGCATAGGTGCGTCTTGCGCATTGACATTACTCATGTTACTTGAGACAACGCCACCACCGCCACATTTCGGACAACCACAACTCGAATTCCGTAGAC
ACGGACCCGTATGGCTCCCTGTCCGTGATGGCGCTAGTGTTTTCTTGATAGGGAGGTCTTCGATCTCTCTTCCTGTTGCTCGTTTCACTTCTCGGAACAA
GGAGTCATGCTCTAAGTCAATTCATTAGCATTGCACCAGAAATAATAAAGTGAACTAGCACGTTAACATACCCGGATCAAGTGGCGTAACATGTAACGAA
GCCATTTGCTCAGATGTCGACGCTTTTTTCGGATACCTGCGCGATAAGGAATCCAGGGCGTCGCTTCCGTCGTCCGTGCCCTGATGATTGTTGTTGTAGT
CGTAGTTTCGGTATGCCATACTGTCCGATTTTGAAGCCTGATCGAGCTCTTCACGTGAACCTGGCGGCGGATGATGTCGAGCTCTCGTGTTTATTCTGCT
GGCAATAACATTTTTTTTTTAATTTAAGTAAAAAAAAACAAGTGCAACAGAGACATACTTTGGGGAGAATGTATGCTCGTCAGAGAAGACCCCGCGCTGT
CTTTGTGTACGAAGTTCTTTAGCTCGCTCTTTCTTCTCTTGCTGCCGCTTGGCATAATCCGTTGGGTCACAGCGTAGGCGAGTAGCAGACTGCTGCATCA
AGATCTGCAGCGAACGAGTCTACAGCAGTCTAGCCGAGATGAAGGGGACACTCAGACCCGGACAATCCTCGCAGACAAGTGAGGTCAAGGCACTAGTGCA
CACTGTCGTTTTCTTTCCGCTGTTTTAGCTTCGCAACTTCTTAAAAGATCTTCAAAGGTCAGACAGACAATGCTATTGATATCCGTCGTAACACCCACGT
AATATTATGTGCCGTTTAGTTGGTAGGTGTCGTCAGCAGCTCCCCAAGCACCTCACGAACCCATGGCTGTGTGAACTGCTGCGGACGTGGAATGTTGACT
TCATCTAACTCGGTTTCGGCAGCCAGAATCTGTATTAACAAGGGTTAAATGGATAAAATAAAGGTTAAATAAACTCATACAAGTCACGTACGTCCTCGTC
GGCCAGTTGCGACTTCTTGACGTCTGCCATGAACCCACACGGGTCTTGAGCGAACTGAGTCATCCATTCTTTCTTCCTCGTGTACATCTGCAGACGCTCC
AGAATGTCCAATTCCTGTTCTTTTAGCAACGCCAGCTCCTTTTTCTGGTCTTGTTGGAGGTCCTCGCATTCCTTGAGTGCACGAGCGCGAGCGTCATCCA
GCTCGGACGTTGCAGCTACGGAGATATCGAAGAACTTTTCGTCCAGTAATTCCGACTCACAAGCCGTCGACAGACTCAGCGTGTACTCGAGATTGATACG
GTTGATAGGCGTCAGATGCTGTTTGAGTGCCACGACAAGCGACGTGAAGGGCAACGACACGCAGTTGAGCACCTTCAGCAGTCTGTCGTCACATCGGACC
ACTCGGCAGTCGTCTGCCTTGATGAGGTTGCGTAGCTTGATGTACTCCCACATCGCCAGCACAATATCTTGCTTGGTGTATGCCTTGGCTGGCCCCAAAT
ACTGACCGACTGCAGCTTCCAACTC