Description :
From Genome Similarity Track
Location :
Scaffold_61:138505- 157846
Transcript NameFunction/comments
g13921.t1hypothetical protein
g13922.t1XP_002906784.1 2-isopropylmalate synthase [Phytophthora infestans T30-4
g13923.t1RAW43686.1 hypothetical protein PC110_g124 [Phytophthora cactorum
g13924.t1hypothetical protein

Sequence
19341 bases(100 bases per row)
CTAAAAATATATGATATTGCAACCGCCAACACTTCCAAGCGGCAGCACTCAGGCGTTCCACTCGATGAAGCAGCAACAGCATGGTCAGATTCAGATCCTG
CGCGACAGCGCACCAGTGGTGGATCTGGAGAGAGAGCCTCGCACGAATCGGTCGTGGGCCTGGGTCTGCTCTGCACTTGTTAGCAGAGACAAAGGCGAAT
GCAGCGTGCACGTGGTCGAGACGGTGATCGTGGACAAGCAGCAGATCTGGGCTTGGTACTACACGGACGCGGGTGTCGTACGCCGCAAGCCGCAGAGTAA
ACTCTCGCCGGAGCAAGTGCATCGCGCGTTCTTGCAGTTCGCCGATGAAGTCGCTGGTCAAGTTGCCACGTTGGACGATGCGACCCGACCGGTTGCAGCC
TGTTGGTTTGAGAAGAGCGATACACCCGGTGTCGTACCGTTCCTCGCTGCGCCAGACCTCTTGGTATTTTTGAATTCGCTCGGATCCGGTAGTTCATGCA
CTGCCGCCATCAGCACTTTCGTCCGTCCGCGCGGTGAACTAGACCCGGGCTGCTATGCCAACCTTGAGCATGAATTCACGTAAGTAAGTCTTATTGTTTG
CGTGTTGCTGGTAGTTCTGATGCATTGTGCTTCATTTTATTTCCGCAGCCTCCAGAAGAGCGGTCGTGTGCAGGGTAAACTCTTTTGGTTAGCTCTTGGT
GGGCAGCGAATCGCGAGTAAGGACGTAAAGTTGAACACCACCGTTAACGAGTTGGTACAGCACTTCATAAGCTTCATGGAGAAAAACAAGAAATGCCGCG
TGGCTCGCTGCGTCTCGCTTTTCATCGTTGACGAGGGTGGGAAGCTGCAGTTGTGGCGGACATCGACTTGTGAAACCATTTCTGGCGCAGCGGCTTTGCC
TTCTGCACCAACCTTCCCCGACGCGCTAGCGTCGTCGTTTCCAAGCACTTACGAGGGACCACGTGCCATGAACGAGAGATTACTGGCTCGAGCCCGTGCT
GAAGGCAGGGGTCCTGATGAACGGCTTGTTGAAGCTATCATGGCGACCGCAGCACCTCACCTCAACAGAATTACGTCGCGGTTGCTGCCAGCAGCATCTT
CCAGTACACGTTTGGACCCGCTTGGAGAATCGGAAGGCAGACGTCGAGCAAACCTCCAGCTTCACAGTTCGACGGACTGGGATGAAGCCTTGTCTTTTCT
TCCAGCTACGTCTTCTCTATCTCGAGGGCGACGACGAACAGTGTCGGCAGCTCATCTCATGTCCAGCCAGAAGCGTGGTTGCTGCGGAGACTTTTGCAGC
ATGTCAATCGCCGAGTTGACTGCTCGGCGTTTGGAACGCAAAAAGGAGCCCACGTTAAGCGAGCAAGCAGGCCACGCTAGGAAAGGCCGGCGACGGACTA
GTGTCGCCACCGCCGCGGCTGTTGCAAGTGCCTTCATGGAGTCCCGTCGCACGAACGACTTGCTGTTTCGGTTAGCAGAGCAACGCAAACCATCGTCGCC
ACAGCGACTGCAGCGTGCCGAGACACAGCAGCCTCAGCCACCAACGCACACCATTCCGTTTAAGCTGGTCGCACAGACTCGGGCTGAGAAACAACTTGTA
GATCTCTTCGTTCGACGGTACCAGAGTGGTGAAGATGGCGACTATCTTGCAGAAGCCTACTACGGAGATGGCGAACCTCTCGGAGTCACGTTTCCGGGAT
ACTATTACCGAGACGTCCAGGTCTGCGCCAACTGCTATGAGTTTTACACACTCGTTGAAAAGGTCCGCATGAAGGCTCTGGATCAAATCGCGCGACGTGG
AGAGAAGAAAACTAGTCCAAACCGCCGAAGTCCAGACAAACAGGATGAAAAACGTACTCGAGAGCTTTCGATAGCCGAGCGAAGAGAGGAGACTGACGAC
GATGGCAATAATGATGTGGAGTATTCAGACACTTTGCAGCATGTGTGGAAGCAAGTGTGGGCGCAAACTTCCGTCGTGGCCGCAGCGATCACGAAAAAAG
ACGCCGCTGAGCTGTACAGCTTTGTAAATCCGCATCCTGCTGTTGCGATGGTGTTGAGTGGTCTGGGGGCTTTGCTTCTGGGGTCACGAGGTGGAGGAGA
CTGGGGTGAGGTCAAACGGGTGATCTCACAGGATAAACTCCTCTCGCGGTTGCATCGCGTGGATCTAGAGGGACTGTCTGAACGTGCCGTGATGCAGGCA
GCAGCTCATGCTCGTAATCCACTGTTCACACCGGCACAGATCGCGCCTATTAGTTCATGCGCTGCGAAGTTCTGCGATTGGATCCGTACTGTGCTGCAGG
CTTACGCGTGGAAGCACAGGCTGCATATGCAAGACACGGGGACACGACGTATGCTTTGCCTCCTCAAATCAGAGATCCTGCCAGCCGGCATTGCTGCTGC
TCAGCTGGAAGACGCGCAACGCGAAAATGGGAAAGTCAAGAAGGTCACAAACGATTCAAACAACGATGATTCGTCACCTACAACGCGGCGCCAGTCTCAG
CAGAAGCAAACTGCTCGACGAGCCATACAAGCTCAGAACATGACACGCCTTGCAGCACCGTCGGGGCTACAAGATGGCGTAGGAGGCGGCACTGCAGATC
CTGTATTTACCTGTCAGGATGGAGTCACGCAGATACCGTACGTAATAATTGGCCAGCCCATCGGTCCAACCGTCAAGTGCAATCTCGTAGTGTTTCACGA
CTTGTTCGACACGCTCGAAAGCACTCGAGTGTTCTTCCGACCGATTGTGGCGCGGAACGCGGGCTCACGAGCGCTGCTGTTCAATTTCCCAGGTCAAGCC
GGCTCTGCTTATGCAGTCGATGATCAAGCCCGCGAAGAAGACAAGCTTGTCTTGAACAACATGTGGCTTGCGCGCCGTGTGCACGAGCTACTCAATTTCT
TGCAGCACACCGCCCAGTTCGTCACCTCGGGTGCTCCTTTTCACATCGTCGGGTTCGGAAATGGTGCCAACGTAGCCTCGTGCTACGCCGTACTCCATGG
CAAAAGCTACGACGGATACTTGCAGTCACTTGCTCTTTTCAATGGGTTTGCGAGCGTGGATGCTCAGCTAGCCGCGGTGCTGCACAGCGCAGTGAATGTG
TTTGCATGTTTGCCACCGACGCGACCAGACTTGCCAGTGTCATTCTTCTGTAAGTTTCTCTTTTCAGAGGCGTACTTGTGCAAGGTCGACATGAACTTAG
CGCTGAGTATCTACACAGCTGTGACCAACGCCATCACGCTTGACGGGCGTATTCGCTTATGCCGAGGTGCTCTCCGTCACGCAGACCTGGGCTCATTGCT
TGCCGAGATTGACGTTCCACTTGTCCTAGTGCAGTCAGTGGAAAACACACTGGTGTCCCCCACGAACGTAGATCCATTTCTCCAGGGACGCGCAAGTGTG
CAGCATGTATGGTCCCATCAACAACCGCATACCAGTGACCTGCGCTCTAAAACCCGTGCGCAGATGAGGAAAGCACTAGCAACTCCAAAGAGTGCCTTTG
TATCATGGCTTCGCGCTGGCCATGAGCTCCGCCAGGAAGCAAAGAGCTACGTCACAGAGGTGATCGAGATGCTAGTCAACTCCCAAACGGAGCGTTCAGA
ACAAGATCGCCGCGCTACAGAGGAAGCAGACGCGCGCCAAGCAACACCGACGAAGCAGCAAAAGGCAGCAGCAAGAAAGGAGACGACAGTTCCGGATGAG
AGCCAACGTGTCCAGCCGTCACTAACTGATCTCGAGCCTCAAAGTGCTGCAATAACATCCAAAACTCCAGCTGAGCCCTTAGTTGCAGATCCAGCAGGCA
ATTCGCTTCTCGTAAGCTGGTCACCACAGCAAACCAACAAATCGCCGTATGACCTTCAACTAGAAAAGTCCGAACGAGCATTTCAGGAGGCACTGCGTAC
GCACGCAGCCCAGAAATCTGCGTACGAGAAGAAGAAGCTCCTGCAACAACCAGGCGCAACGCTGACCACCTCGACAACTGAGATCGCCGAAATCCCAATA
ACTCAATCTGTTGTGCCCTTGGACATGCTGCTTCCTCCTGCTCTTCCTGCTATCGTGATGCATGAAAATGATCAAACGTCATGTCCGAACGAAGACAATA
GCGATACCCAGCTAGATGACGATATCGATGATGTACGTACCAAAATCCGTGCTGAAGAAGTACGACTTGAAAAGGAGGTCGAAGAACAGCGTGAAAAGCA
TCGCGCTGCTACTGAGCAACGGATGGCTGCTCTCAGAGAGGAACAGGAGCGGAGGCGACGTGAGTGGGAACAGGAGGATCGCGAGCGACTTGCAGCTCTT
GAAGCACAACTACAGGCTCAACAAGATGAGCGGCTTGCTGAATCTCAGCAGCGGGACCTAGACCAGCTCGCGATGGATGAGGCAGTGCTTGCTGCCGCCA
GTACAGTCTTAGAAACATCAGTGTCCTCACCATCGCTGATTCTTGAGACGTCTGTCGAAATGCCAATTTCACCAAAACAATCCGCTAGTACGTTGCTGGC
TCCTTCCGTGGAGAAAACACGACAACAGATTCAAGTACAACCAGAACTACCGAGTATGTTTGACCAGCTTGAAGCAGAAGAACACGCTCGGAGACGCCGA
GAGCAGAAACGACGAGCCTTTGGGCCTGGACAGACAGCAGGAAGCCACCTAACCGGCGATCAGTACGACGAGGTACGGACTTCACTAAAGGAGGCCTTCC
GAGAAGATATCCGAGCGAATGAGTCCAACATGAAGCGCGAGTTGCGACGACGGCGTGACGCACAAGCCACACGAGTCCAAAAGTACATCCGCCGGTTCTT
GGCTACGCGTCGAGTTGATCGTATACGACGTGAAACCCAACAAGAGCGCGTCAAAAACTTTGCTGGTGGTGAAGTCGTGAGGATAGCACGGGGCCGCTTA
GGCCGTAGACGATATCGTAGACTGTTTGAAGAGAAGGAAGAGGCTGCAAGGCGATTACATGCAACCATACGCATCCAGACCGTCTTCCGAGGCTTTTCGA
ATCGCAAGGCATACCGTGCAAAACTCCGAGAAAATAAGGCGTGCATGTTAGAGCGAGTTTTTCGTGGTCACCTCGGACGGAAGCGTGCCCGGCGACTGCG
CAAAGAGCAAGAACGCCGCCGCTTTCAGGACCGTAACGCTGCCAAAGTGCAGGCTACCTGGCGGATGTACATCGCGCGTGGCAGATTTCTCACTGCTCGG
TTCTCCGAGCTTGCAGCTCTTGAGATTCAGCGGATGTATCGTGGTCTTCTGGGTCGACGAGAAGCTGCACGCAAGAAGCAGTGGCGCGATGCACCGCCTG
GAGCTGAAAGACTGGCGCTCGGACTTCAACTAATTGAAGGCTCGAAGCAGGCTTTTGAACGACAGCAGAGCGAGCTTGATGCGCTTCATCGCGCACAAGA
AGCAGCCGAGCGTCAGGTTAGTGCTGTGCACAACGAGCTGCGTGAAGCCGAAAAGGAGCTGGCTGTGCTGGAGAACGAACTGCAAGAAATCGACCAGCTA
GACGCCGACGTGAGAGAACTCACACACGAAGCCGAACGACTGCACGCTGGCGGTGTCGAAGGATTGCTACGCAACCACCGATCATCGTTGCAACATCAAC
CTCTTGGAAACGGTGTACCGGATACGTCTTCACCACCAGACAGCAACGACCGTGCACCATACCAGCTTGGGGATGAGAACGCGCTGGAGACGAGGGAGGC
CCTGAAAAAGCGCCAGGCAGACGCGTACGCCGTGGAAATGGCACTCAGCATCAAACGCAGCGAGCGTGAAAAGAAGAAGCGTGACCTGGAAGCGGAGTTT
GCTGGAGCGTTTGCTGAGGTGCAACGAAAGCGAGATGCATTGGCTGCACTGGAAGAGCGGCTTGCTGACATGGAGCAGACTCGCATGCGAAAGGATCGTG
AATTTGCACGTTTGCAGCGGCATCTGATGGAGTTGCTGGAAGAGCAAAAGCTGGAGCTTGAAAACTTGCGCGAAAGGGGTATTGAGCTCGAGACAGCTAC
AGCCACCTCGGCAGCAGCGGCAGCAGCAACGGCAGCTAAAGCTCGCGAGCACGAAGTACGGTCGCAGGCAATGTTTGAATCCACGGAAGAGCTCATGAAG
TTCCAGTTCATGTCGATGTCGTTGTCGTACTTCAGTTCGCTCAATATGCTCAAGAATCTGCGCGACATCAACGCCGACACCACTGCTTCAGCCATCACTT
CCACAGCGGAGACCGCAGCCACTGCTGCTGCTGCTGCGGCTGCCGCAAACATTACTCCAGTCACCGCAGCTCTCGCGAAGAAGACGCCAGGTGGAGATGC
CATCAGCAATTTACTAACGACTGTGGCGCAGCGCAAGCAGCAAGAGCTGGTGCAGCGACAACGCGAAGAGGAAGAGGCCTTAGCACCAGGAAAGCAGCAG
CCGTTGCCTGAAGAACTACGCGCGTGGACCGTGGGCGATGTTGGTAGGTGGCTCGACAGTTTGTCATTACCGCAGTACAAGGCTGCGTTCAGCGAAGGCG
CAGTGGACGGCGAGTTCCTCATTGAGCTCCGTGCTGAGGACATGGCTGAAGTTCTCGGCGTCTCGCACAAACTCCATGTGCGCAAACTGCTGACAGCACG
CAACAAGTTGCTGCCTCTGACGGCGGCGGAGCGGTCTCAACTAGATGCCGTGAACCACGAGGCAAATGCTGCACGTGCACGTGGACAGGAACCGGCAGCA
GGAGATGAAGCCTCGCTGGAGGTGGACACCGTATTCTCGCAGGCGCGCAACGGGCGGATGAAGCGGCTTGTCGAGAGTCTGGACGCAGGCTTCCCTGTCG
ACAGCGAGGACGACAAGGGTAACACGCTGCTGCTGCTCGCGTGTCAAAACGTGAACCAGCGCATGGTAGAGCTCCTGGTTACACGCAGAGCCAACTTGAA
TCACCGCAATGCACAGGGCAACACACCACTTCACTTCGCGATGGCCTACGACGGTGAAGGTGTCCTTGGCGAGTACCTGATCGCACACGGCGCCGACGAC
ACCATCGAAAACAACAGCGGCCTCACAGCCTACGACGGGCTCACAGCGGAGTAAATGGCGTATCAATCACACAGGACAAGTTGCTAGAGACATTCGTGCC
AGCTCGCATCGTTTGCGAACTCGGGACACTATATTTTTGCTTTCCATTCTGCTGGTGTACCAATGAAGCCTTCCGCAATGCGCACGGCGATTAGATAATA
CATACTACAGCACTCGCTTCCACAACCGACTTTCTCCCTGCTCCAACAATGCCTTGCAGTGCTCCACGATCGCTTGGCGAGCCCCTTGTTACTTTGATGC
TGTATTCTCGTAATCTTAGGCGTCCACCCGAGCCTCAGTCACACCACGCACCTGGGAGGCCATCATACGGTTAACGGCGTTGACGTAGGCCGTAGCCGAC
GCTACCAGGATGTCAGTGTTGGCGCCGTGGCCAACGAACTGGCGGTCACGTGTCACACCGGTCTGGGCGTTCACGTGCTTCTCATCTTCCGTCTTCTCCT
CCTCCTCCTTGTCCTCCTGCACTCGCACGGTCACCTCACCCAGAGCGTACGTGCCATCCGTCACACTCTCCACGGAGAAGTCATTCAGCTTGATGCTGTC
CATGCCCGTAGCGCGCTTGATAGCCACGTAGATGGCGTCAATGGGACCAGTGCCCATGGCAGCCTCGCTCACCTCCTGTCCATCCTTGTGCGCAAGCGTG
ACCGTAGCCGTGGGCTTGACAAGGTTGCCAGCCGTCACATGCACGGACTGCAGCGTCCAGAACACCTCGGGCTTGAACAGCTCGTCCGACACAATCGCCT
CCATGTCAGCATCCGTGACCGTCTTCTTCTCGTCAGCCAGCACTTTGAACTTCTCCACGTAGTGGTCGAGCTCCTCCGGCGTGAGGTTGTTGTAGCCAAG
CTGCTGGAGACGCTTGCTGTACGCGTGGCGGCCCGAGTGCTTGCCGAGCACCATCTTGTTCTCGCTTAGACCCACCGACTCCGGCAGCATGATCTCATAC
GTGGCTTGGTGCTTCAACACTCCATCCTGGTGGATACCAGACTCGTGCGCGAAAGCGTTAGCGCCCACAATGGCCTTGTTGGGCTGAATAGACATACCGG
TGTAGTGGCTCACCATACGGCTGCAGCGGGTGATCTGCGTCGAGTCCACGCTCGTGTACACGGGGAAGTGCTGCGGGCGCGTCTTAAGAGCCATAACAAG
CTCCTCGAGGGCCGTGTTACCGGCACGCTCACCGATACCATTGATCGTAACCTCAACTTGACGCGCGCCGCCCTGAACAGCAGCCAGCGTGTTGGCCGTG
GCCAAACCCAGGTCGTTATGGCAGTGCGTGGAGAAAATGGCCTTGTCGCTGCCCTCCGTGTTGTCAATCAGGTAGCTGAAGAGCGATCCGTACTCTCCAG
GGACCGTGTAGCCGACCGTATCGGGGATGTTGAGCGTCGTGGCGCCAGCCTTGATGACCTCAGCAAGAACGTCGCACAGGAAGTCGGGGTCACTGCGACC
GGCGTCCTCGGTGGAGAACTCGACGTCGTCGGTCAAGCTCCGCGCGAACTTGACGGCGTCCACGGCGCGACGGATGCACTCGTCGCGCGAGATTTTGAGC
TTGTACTTGAGGTGGATGTCGGACGTGGCCAGGAACGTGTGGATGCGGTGCTTTGGCGCGTGCTTGACAGCATCGTAGCAGCGCTGGATGTCCTTCTCCA
TGGCGCGCGCGAGGCCGCACACGGTCATGGGCTCGCCCGTCGCGCGGTTGGCCGTGAGCGGGCCGACCTCTTTGGCGATGGCCGACACGGCTTCGAAGTC
GCCGGGCGACGAGATGGGGAAGCCCGCCTCGCACACGTCCACGCCCAGCACGCTCAGACTGCGCGCGATGTCAAGCTTTTCCTTGAAGTTAAGCGTGGCG
CCGGGCGACTGCTCGCCGTCGCGCAGCGTCGTGTCGAAGATCACGAGGCGCTCCTTGCCGGCCTCGGCGGCGGCCACATTCGAGAAGGCGCGGCTCGCGT
TGGCTCGGGCCGCGGAGGCCGAGCGCTTGGCGATCGACTGCATCATGTTGGTGTGTACGGGAGGAGGTCAATGGGCGGAGCAAAAGTGCACGTCACTGCT
GCGCTGCGGATTGCGGAATGAGCCGCAAAAGTGCAACCAGCCGCTCCGGTTTGAGCAAACACGCGTACAGAGGTTGAGCGGCTGCATCAGCTCCAGGCAA
TTAGATGCACCACCAGCAACGGCGCGACCGCGATCTTAGCAGGGCCTTTTGACCAATCGTATTGCGCACAACAGACTTTTGGCCAATGGTAGGGATGCGT
AAAAATGACGTAAAAAGTCATGCGTGGCGTAAAAAAAAAGAGGTAAAAATCTCTTGGCGTGCAGGCCAGTCGCGCTGTCCCGGTGCTCAAGCGCGAGCGG
TCATACTGTATCATCAGCACTTCACCACAAGAACGTGCGCGAGGCGCCCCAAAAGTTCAATGCCGCGCGCCTCCAACACGATCATCAATATGTTCAATCT
GCTCGGCAGTTTATTCAACCTGCTCGGCAGTTCAACATGAGCGGCGGTCATGCGCGGTTCGACAGATCCCAGCAGCGACTTCAGGGCATGGACAAAATCA
CCTTGGACATTAACTCCTGCTTTGCTGCAGTGCCTGCACCTGGTGGCTGCAACGCTATCACATCTCCATACCTTATCAATGGTCTGCTGCGGCTCATGGC
CGAGCACAAGCAGCGAATGAGCTTGTGGCGTCCAATCCGAGGGCCGGTGCAGCCGTCCTTTCCTTGAGGTCTCATCAGATGTTCACCTTCAACCTGGCCT
TGAACTCAAACAGCGCGTCAAGGTGGCAGTGCTTGCAGTGGCTCTCAGCCCAGTGAGCTGAGCTCACATGGAAGGACGGCTCGCATCGGAGCACCAGACT
GCGGTGCTGAGGCTCCGATCGAACGTCTTTGATGTAGATGTACCGTCAAGGTGGTACCGGAGACGACTCTTCATTGGCTGATTATCGCATTGACCGTTAC
GCCGCAGTGCGCCATGTCCTCGCCAAAAGCATAATCGTCGTGGAGCCCGTGGTCTTGGAGACCAGTTCCGCTCCGGATGGCGTCTCGGCCGCTCGAAATG
CCCTCGGGGCGCATCGCCGCCCGCCCCCCAATGCGGCAGAACGTGGCTCTGCGTTGGGTGAACGCGGTTGTGCCAGCTTCGGCCGCATCCAAGACCTCGC
CTTCGCCCATAAAGAGATGGCCTCCCCCGTCGAATGTTGAAGCCCCGCCTCATGCTCCAGTGATTGCAACATCGATGCCAGCGCCTGCAGTGGAGAAGAA
GAAGCCGGTGTCTGCGGGATTTCAGTCTGCGCGCGCCGTGTTCGAAGCCAAGAGAACTACAACTAACCCGCCGCCAACTCGTCGCCGATTGCCGTTCCCC
GCCCCACCTGCGCCTGCAGTTGTGAAACAGCACTCGGTAGCATCGGATTTGTCCAGCTCTTCATGCAGCACGGTAGACTCCGAGAGCAGCCGCATACTGG
AAGAAACCATGGAAGCGCAGCATGAATTCATGACACGGTCGCCGGTTCGGCCAGGCGAGGCAAAAAAAGTGGAAAAGAAGTCCTTGACGATCACCTCTTC
TGTTACCGCAGCAGGCCCTGTACCGCGATCACCGCTTCCAATTAAACAAGCCGCTAGCTCTCACATACCTGCATTGCTGATGACAACATCCGCGCAGGCG
AAGCAAGGACAGCCCAGTATTAATGCCACCATTGATCCATTCCAACTTCTTCTTCCAGTTGGAGCGGTACCAACACTTCCCGATGAAGTGTCATGCGTCT
ATGACAACGCTGCGATTGAAATGCAGAAGGGCGTCAAGAAAGTAGTGCGCAAGCTGCTCAAGAAAAACAAGGCACGGCAAGAGGAGTTCAAGGTCAATTC
CCGGCTCTTTGGAACCGATTTCATGGACTCGCAAGCTTATCTGGACACGCTGATCAAGGACTTTGGCGCAATTCGTGCCCTGCAACTTGTTCCGTGCTTG
TTGAGCATCCAGCCCGATATTCTGAAGAGCAAGGCTCTCCTTCTTACCGCCAAAAACTATCTATTGCGAAACGAAGAGTCATTGGAGTGTGAGCTGCGGG
CCTTGACGGCACCAAGTACCAGAGATAGTGCTAAGACTGATGGCGTATCAGTTGTTGGCTCTGTGGCCATCCCGCTCCCAGACGCTGAGGTGAAGACTCT
ATCGCCAATTATCAGAACTGCGTTGAAGGTGCCTGCACACGCCTTGGCGGCGGGACCTCAGTCGAGAGAAGAGGTCAACTCCACGGCTACAGTCTGCACC
TCTATGTCTGACCATGTCGATACTGTCGATACTGCTGCCGGCAAGAACGATTCTGCAGTGTTGCCAATTTCGGCTTCTAAAGATATAGTTTCGGCTACCA
TTTTGGCGCTGAAAAAACCGGAGTTCACTAGCCCACCAGGAGGAGTATCACCAGCGACCACTATCCAGTTGGCTGAACCCATGCCAGAACCTCAAGAGGC
AGCACTAATTGGGCCACCGCCCCATGTGACCAATATTGTGGTGAATGCTCCCACGCCGGCGACGACTACAGCGGTGCGCGGGATTGATGCCAATCCAGTT
ATCAAGAAGAACTCCGAGTCGGATACTCCAAGCGACAGTGGGGATGAATTTCGTGCCGAAAATCTCTTCGGCGAGCCTATCAATCCTACTTCTCCGCAGC
AACAGCAGGAAGTAGCTGCCATCTCCCCGGTGTCGTCGACGCACAGTTTCGACGAAGCGGAGAGCTTGTTCGGTGAGCGTCTGTCCTGCTCGTCTCGCTC
CAGCACGAGCCGGCGAAAGACTGTAACATGGGGCGAGGCCAAAACAATGGAGGTCCCCGTACAGCGAGCCTCATGCATCAACAAGAAGCCCGCCCCGCTT
ATTTTCGGCCTTGCCACCGCAGGCGCCTTCGACTCGGACTCGGACGACTCAGACGTGGCCTGAAAATGAAACATACTCAAGTGTAAAGCATTGTGTCGTT
TTGCCTTGTCGAGGCAACCGCAGCTTGCACCGACATGACAGAACGTAGTTTCACATATTCTAGCACACAGGTTGAGGTTCACAATCCCTCGACAAGCAAG
ATGTCTTCGCCTCAAATGCAGCCGCGGCAGCGGCCTAGCAGCGCCGCGAGCCTCCACGGCGACTTCCGGGTGGAAGTGCTGGGCAGCCAGGAGTCTCTGG
ACCTGGACTGCGGCAAATTTTACACGGCAAGTAGTGTGTGTTGGCCGCTGTAGCCACGGTCTCCCCAGTCTCACCTTGTACGGCTGCAGGAATACATCCT
GCGCTGCTCGTGGATCGAGCGCAATGGGACGCCAGAGGTTCGTTGAGCAGCAGCTTCATTTGCATGGCATTGAAAACAGGAGACTGAATTGGGCGACGCT
GGTGCACAGATTTGGGACGTCGTGCGACGGTACCGCGAATTTTGCGCAGTCGACATTTTGGTGAGAAACAAGGAGCAGTCCACGCATTCGTCACGTTATA
CGGCTAACAATGTATGCAATACCTATTGTGTGTATTTGCAGCTGCGCGAAAAGTATCCGTCGCGGGCGCCCATGTTCCCGTATCTGCCGAGCAAGAAGTA
CATCGGGTCGTCCCTGTCGGCCGACTTTGTGGACAAGCGGCAGCGCGACCTCGGCTACTACATGATGTCCATCCTGCACAGCTGCCCGCTGGTACGCACG
TGCTGAATTCTATACGCCTGATGCTCTTATTACCCGCCTATTGACACGATTTGGTGTTGGTAGCTCGTTCAAGACGAGATCATTGACTCGTTCCTGGACA
TTAAGCGGCACATTTTGGAGCGCGCGCGGGAGGAGTTTAACGACAGCCGCTTGACTTCTACCCCCACGCACACGACGAGCAGCAACGGCGGCATGAGCCC
TGCACGGCTGCAGCTCTAGTTCCATCAATTCAAATACACTTATTACTTTTGACCAGATCAAGTCTCGTCCCCTCGCTCAAACAGCAATTTGCCGAGAGAA
GGAAACGAGTATACAAAGCCCCATACAAACCATAACCCCCTCTTTAATCCGATATGGACCATCACTCTGCGCAAGATTTAGTGGCTGCACGCACAGCAGA
GCGAGCTCCGGACCGGCCTAAACGTGGCGCGGCGCGAGTAAGTTTGGAGCGTGTTCGTTACCAGTCCCCGCGCGAGTGTACGAGCGCTTCCAGTGGACGA
GAGCACAGCCGCGTCAGGGGAAAAGGGGGAGAACATGGCGCTCGCAGACATCATGTCGGTGGAGATGAGTGCCAAATACATGGACTCTAGCAGCTCATCG
AGTCTGTCGTCGGACTCGGACGACGTGTTGTCGTCCTCGAGCTCTTCGGCCGTCTCGTCGTCGAACTCGGAGTCGGACTCGGACGCGCCGCGAGCGTCGG
CCAAGAAGAAGAAAGCAGCAGGTCCTCGAGGACGCGCTGGGAAGAAGGTGGACGTGGCGCTCTCGGACTATGAGGACGACTCGGACTTGGACAGTGCCAC
TAGTGGAGGCAGCAAGAGGAGGAAGAAGAAGAAACCTGCAGCACCCAGACGGTCGCCGGTCAAGAGCAACGGGAAAGCCAAGAAGGCGGAGAAAGCGGCT
CCTGTAGTAGCGGCGCCGCCGAGTCTTCCACCCCCTCCTCCGCCTCCGTCGCCTCCTCCGGCTGCACCAGATGAGGAATCTTCCAGTAACAGCTCATTCA
GCTCCAGTTCCAGCTCGGACTCGTCGGAACTGTCGGACTCGGAGACAGCGCTCCCCGTTCCCCCGCCACTCCCACCTGCGGCTGGTGACGCTTCTCCTGC
AGTGTCTGCGGCTGCGAGACCGCCGAAGCGGAGAGCTTCGACCAAAAAGAAGGCGGAAGTGAGTCCGTCGTCGCTGAAGGTGACGCTGAAGCTCCCGCCA
GGCTTTATTGCAAAAGGCGGGGGAGCACCTGCAGCTAGTAGTCGAGCTCAGGTGAACGCCCAGGCGACAGACGCGATACCTAAACGACCACGAACGCCCA
CAGCTACAGCAAAGGCTGCAACAAGTTTGCGGTCTGCCAAGAAGAAACAGCCAGCAGGTCGTGCCCAGAATTCTGTTGTCCAAGCGAATGGGACATCCCC
CGCAGTACCGCTCGTTCCGGTTAGTCCTCCCGTTTTGCCCAAGCTGATCCCCACTGGTCCGACGGTCCCTTCAGGCGAGGTCCGAGGTGCGAAAGAGCTC
TCGCTTGTGGACCCGGCCCTTGCCAGAGACAGACCCGAAGAAATTATTGAGTCGAATATCCCGGCACACTTCAACGACGCTTACGCTCATGGAGGCGATA
CGCTGCGCCTTTTGGACATGTTCTTTTTCTGCGATGAAAACGGGTATGGCGAAGCCTCACTCTTTGTTGGATGGAAGATGAATTCTAATATCGTTGTTTT
CCTCGTGCCGCTTGTTTCTACAGCAAGGCTATTAGTCTCGAGATTTTAGACCGACCAAAAGATCAGCGCCCGAAAATCATGGGGTTTGGAACACTCGTAG
AGCATTTGCCACTAGCGGAGCGTCCGCTTCCAATTCGGCCTATTCTTGCGTCCCCAGCATTTCCCTCGCGCTCCAAGAAACGCCCACGCGCGGATTCCGC
CTCGTCGACCCCTGCAAAATCCCCATCCGCTAAAGCAAGAGCGAGGCCCAACAGAGGTAAACTGTCGTTGTTGCTGCTGTGTGTCGAACTGGTAATGCGG
TTTTGCTTATTGTTTGCCATGTCCTAGCAGGAGCCAAACAAAATGACAGCAAACGCCCAAAAATTGAGGATGAAGCCATTTATCAAGGCGATGGCGAATT
CGAAGACAAGGAGAGAGAGGTTGCTCATGCAGCAGATTCCTGCATTTTCCAACGGTCGACCGTCTATCGCTTTCCTAGCCCGTTTTACCCGAATCAATTG
TCTCAAATGGATGGACAATCCGATTCGGATAGTGGTGGTAGCGATTTGACTTCAGACGACGAGGATATTCGTTCTGGCCGAAGTGGATCTGGAGCTGGCT
CCGAGAACGACAGTGAGCTCCTCTCGTCCGCCACCAGCAGTTCGAGTGGTAGCGGTAGCGACAACGAAGTAAACTCGGGCAATTCTTCGTCATCATCCAC
TGGTAGTGGTGCTGAGAGCGGAAATGGTACGACGACAGCGAGTCGGCGCTCGTCGGCTACTACCGGCAACCCGGCGGTCATTAAGGCCGACCACTTTCCA
CAACGAATTGCTGAACCAGCAAGACCTCCAATTAACAAAGTGCAGAGGCGACCGAGCACCAGCGTGGATTCCAGAAACGCGGGCTTGCCGGCTGATGTAG
TCGGACTTATGCGAACTGACCAAGCCGTTGACGTCAATGCAAAGGGCACTCCAGATGAGCTTAATTTGATGGAGTGCGGTTTCAGACACCCGTCTAGCTA
CGCTCGCACTCGCGTTTGGCTTCCTGAGATCACGGATTGGTGCCTGGACTACGCTGAGGGGGACCCAACACTGTGGGTTGTCACGCCTCATTCCTGGTAC
AAGATTGCAGGCCCGCTGTCTGGACTGCTACCTCACTCATCGTACCGTCATACTTTCAAGCATGTTCGTCATCTCTTTGAGGCAAGCTACCTTGTGGCGT
ACGTTCTAAAAGAATGGCTGCCGATTAACAAGAAAGTGTCCTATCGAGCCACTCTCCAGCAGATTATTGAGCTGTCTTTAAAGGGCAGATTTCGAGTGGT
ACGACTGCATACTGCATTATGTTGGTGGTGTGAGGATCATGACTTATCGTTGTCTAACGTTGGTGTTGTTGGATAACACGTGTGTTTGTAGTCTGCGTGG
TTTCTTGTGAAGAATTACCCGTTCATTCGAGCCCAGATTTCAAATTTGTTTCCAGACAAGGAAGTGTATCTGGAGTCAATGTTCTTTAAACAGCTGCATC
GCCTGCACGAAAACTACACGCTACGTGAGGCAAGACACCAAAAGGAGATGGCCGAACGAGAGGTTCGACGTGAGAAGCGAGAAAACGAACGCCTTCGGAA
GAGACAGCGAGTTGATGATGCGAGGCAGCGCATGATGGACGAGCGTGAAGAAGAACGAAAACTGAAAGAGCACGGTCAAAAATACCCTGTCGAAGATTTG
CGACTGCTTGAAGGAGATGCAGTCAACACCAACAGCCTCCCTTTGGCGTGCTCGAGTCTAAAGGGAGTTGAGGGCCCTCTTCTCGGTGAGCTCATCATGG
CGTGGCAAACGATCAGCACTTTCAAGGATTTTGTGGGGCTTGAATCGATTTCGTTGGAGGCACTTGTGGAGTGCATTACGACTAGTTGCGACGAAGGCAC
CCATGTGGGATTAGCGCGGATTTTTATGGCGTTCCTCCATGTCATCTTGTCGGAAAAGTCGTTTATGTCGCTGCTGGATGATCTTGTTGTTGAAGGTAAT
ATCAAGGTCTCAGACCTGTTCGTGAACAGTGAAAGGACTTACGGAATTTGCGAGCGTGCCTACGGTGACATGTTGAATGCTGTCACTTGGCAAGAGATTC
TCCGTCAATTGATGTCCAAGGACATGGGAATCGACCCATCTATTGGCCACGCAGAGCCTTTAGTTGGGTGTGAAATCGTCCGGCAGACGCTATACATGCA
AACCAACTCGACACCATTCAATACTCCTGTTGACACATCCGCCAAGGGCCTAGAGGATTACTCGCAGATCATCAAACACCCAATGGACCTGGGGACTATC
AAGAAGCGAATTGATTCAGGGGGATATGAGGGGTCCGACGGTTACGAAAAGTTCGCGGGGGATATTAGACTGGTGTGGGATAATGCTGTACTGTACAATG
GCGAGGAGTCAGAAGTAGGGCGCACTGCCTTAGCATTGTCGGACGTCTTCGAACAAGATTACGAGCGTTTCGTGATCGGACGTGTTCGTGCAAACCAAAG
CAGGATGGAAGCGTGCAAGAAGGCTAAAGAAACGCTGCAAGACTCATCAGCAGAGAAGGTCAAGACGTTCAAGTATGCCGACGTTGTGTACGGCCTCTAT
TGCTTCGAGTTCCACGAACTTCCGACGCCGTACAAAATTGGTGCTCTTTCGTGGATTTGTTCAGAATTCTTGACCCTTTCTAGCATTCGAACCTACATGG
CATCTCAAGTGGATCAGGAGATGCTGATTCACAGGAATCATAGAAAGCGCGCAGCCGATTTGGACTCACAGAGAAAGCACTCCGACAAGATGCGGCGTGA
AAGAGAGAATGCCTTTAGAAGAGATTGTGCTAACCAAGGCATCCATCCCAATTCGCACAACGTTTTCTCGGAGGGTATTAAACGCAGGCACGAATTTATC
GGCAAATTTTTCGAAGACATTCAAGCAGAGAAAGCTGAGGACGATAAAAACGTGGAGCAAGAGAAGAAAGTTCAAGCAGAAGAAATGGCGAGCGAACTAA
GCTCAATTGTTATTCGTGAGGCCCCCCTAGGGAGATACAGATACCACAATTCGTACTATATGTTCAAGCATGATACGAAGCCGCGGTTGTTCATCGAGCG
CGGGGATCCTGGAGAGTTCGTGGTTTGTGCCAGCAAAGCTCAGCTTACGACAATTCTGGAGTGGTTAAACCCTAAAGGAGTTCGGGAGCTGGACTTGTTG
ACGAAACTACACGAGGTGAATGATAAGCTACTTAGTGCCTTCGATGAAGAAGAAGGCAAGCAAGACGGAGATACCACCACGGAGTTGGTATGGAATGCTA
AGGATGGTATTGAACTCCAAATGTTCCCTCTTCCGGGTGGCGCTATCAAGAGTGAAACAATGACTATTACAGACGCGGACAAGGTCATCAAGTCACACAA
CGTGACCCGCAAAATGTTACTTAGTTTGAAGCAGCATTTAGAGAGCACAAACACGCTGCCTGCTTCTTGGGAAGGTTCTGAGACGTGGAGTGATCGTGTG
GAAGAGGCAAAGGTATTCAAAGAGCAACTCGATCTGTTTGCAAAGCTGGAAAATGCTGCAGTGACAGCCCTGAATTCAGGCGTGGAGACAATCAGACCTT
CATGGCAGCGGAAGCGACATGAGTGGCGGTTGGCACTCGAGGGTTCATGTACATACGCGCAGTTAGTGTTTCTACTGCATCTGCTGTTGGAGGAGTTCAT
TAATGTGGAGGCTTTCATGGATCTGCACATCCGACTTGATCGGCGTGAATGGCTTAAGCTTCGACCTAAGGAGACTCGGAACTTTATTCCTGAGTCTGGA
AATGTTGTCGTATACTTCGGAGATGGCCATGCCCTGGCGCTAAAAGAAGACGAGAAGAGCAAGAAAAAGCGCTTCACACAGAAAAGTGATACTCCTGTTC
GAAATGCAGCAGTTGTCTGCACGGTGGAGAAGGTATCTTACCACCACGGCGGAGGTGACCCGTATGCGTTGGCGGTATTAAAACCTGTCTCGGACATGGC
TCTGCACGAATGCATTCGTAAGCCTGGAGAGCTCTTGTGCCCCCTGCCATCGCGAGAACAAAGGCTTGCGAGAGTGTTTCTGCGAGTTTTGGCTAAGCTG
AAAATGCTAGCTGACGCCGGACCGTTCCTTGAGCCTGTGTCTGATCGGGAGTTTCCACAATACAAGGAAATTATTCCTCAGCCGATGGATCTTGAAAAAA
TAACCTCCAAGGCAAGCAAGCTGGAGTACAAGAATGCGGTTGAGTTCATGACTGACCTGAGGCTCATGCGCGATAATTGCCAGCTCTTTTGCGAAGGCCG
CTTTCCGACACTGCCGCCGTTGGCCCACAACTTGGTAAACGTTGCGGATGGACAAATCAAAAAGTGGGGTAAGGAAATTCGTGCGTGCGAAGATAACTTT
GATGGCTCGTCATCGATGAAGAATAGCAGCACGCTGTCTCCGGAAAAGAAGGACGCTATCAAGCAAGATGAATTAGACGGAGGAAAGACGGAGTTGCCAG
CCCGTTCGATCATGACAATTTTGCGCCTCGAAAATCGATTGCCCGAATACATTGTGGATATTAGTCGTTACGCGTGGGCGGTGAACCGTACATGGCATTG
TGGAGAACACTTTCGTATGCTGTTCCGCAACCCACAAGGGTACCCAGGCGAGTACTACGGAGGGGTAACCGCAGGGTCCTTGCCATTTGATGATCACGGA
ATGCTGCCATGGGAGGCGCTGCGTATTACATGGGACGAAGATGACGGGTCGGACGACAATCGCATTAACCCATGGTTCGTAACTTGGCTGGTGTACAGGA
TGCGATGTTTGTCTGATTTCTCACATTATTTAAACTTGTCTGACGAACAGGGAAGCGGAGTTTCCTCGGGGTGGAAATCGGGCGTAGATAGAGATAGATG
TTCCAAGCTCTCGATTTCGCTTAGGCTGATTAAAGTGCTCA