Description :
From Genome Similarity Track
Location :
Scaffold_4:1384792- 1390116
Transcript NameFunction/comments
Phyin_T30-4PITG_03318Putative uncharacterized protein

Sequence
5324 bases(100 bases per row)
AATACTATGTTGGGCGAGACTCCACAACCAATAGATAAAACAAATGGCAGCTACACCCACTCATACAAAGCAATTAGAGACGACCGAGAGCGATTCCGGT
GCACTACTTGCTGCTTCCGAATCCACTGACGGAAACCGAAAGTCCCGTCACCGCCGATTGACTCACGAACTTCGCTTTCCAGGTCGAGGTCATCATCGAT
TAATGCACATGAGCCACGGTCGCTCAGCGGCATCGCGTCCGCCTCGCGAGGTTCCAGCTCCAACGAACGAGTATACCGACTCTCCTCGGAGGAATACGGC
AACGAGACGTGCAGCAGTTTCTACAGCAACAAAAGAGATAATTAGAAAGTGACACCAAGACCCGAGATCGCATCGCAACTTACGTCGACATCCTCGTCGT
TCTGGAGAGTGTAGGCGACAGACTGTCGATGCAAGATTTCCATCGACAGCTCGCCCATTCGTCGAAGCCGGCTTGCATTTACCAGACCGTTCTTGTCAAA
CGTAGGCAACTCGTTCAATCCGACGAAGCCCTTGAAGATATATACGAGATTAGTACATGTAGTGTTTACCATAACGTAACGATGAGAATACACTCACTTG
AAGATACAGGCCAATGTAAGGCATGCTTGGGTTTGTAGTCTGACGCATCAGGCGGTTCATCTCTCGACATCCTTTGTCTGAGAGTAGTTGCATCTCGTTC
ATCTTTTTCTTCGCAGCCACACTCAGCTACAATACGCAAGTAAAACACGAGTTATACAACCAGCCATCACAGAGGTACATGCTTTTATGGAATCGTACAC
AGTCGATCGTCTTTCGAAGACGCTGAACCGCAGTAGATTGCAGAGCGTATAAAATCGAAGCCAGCGTGTCATGGTTGTGTAAGGAAATGCAGTATTCCGC
GGCCTGATCATAGTATACGTACAGTTTAGCACACCGAGTACCTCTTTAATATACTTCGAAGTAGTACGGTAAAGTCATCGCACCTTGAGGTAAAACGAAA
TCACTTCTGCCCGTTCTTCAGGGGTATCTTGAACAAGAACAGCGTTGATGACGTACGCAGAGATCTACAAAAATACGACAGGTACAAGCACTTCAGTAAT
AACCCCCAGACTATGTAAATATTTAGCATCACGTACGTGTTGGAACCATCGTTTGATGCTGGTGAACTCAACTGAGTGCTGCCTTTTCGAGCCTGGCGAG
ATCAAATCGTGGACTACAGTACAGATGATCATACACAACAAAAGATCAGCTCCATCTTCACAACAGCTGTGTCCAAATGGAAGCTCACCTGGAATCTTGC
AGAAGACTGCGTGCGTCAGAAGTGTGCATTGTTCTGCCCACTGCTCTGCGTCGATATATCTGCCGAAAAGCAAACCAAAATCAGTAACGCTCAAGCCATA
CAAGCCTCAAATCTTCGACTTACCGGTGCAAATGCCTCGAGAAGGGCTCGTTGGAAACAAGTTCGATTCCAGATTCTAAGCCGTATAATGTGGTCATCAT
TCCAGGGATCATTTCGTAGTTCAGTGCGTATTTTCCAGCCCCACGCAGGGAAAAATATCCCTTGTAAAGAGCTGTGAATTCTTCAACCAAAGGCACCAAC
TTCTCTTTCGAAACGTCAACAGCGTGGCCAACGAGGCTATAGAAACGATCACGCAGATCGTCACTCTCCTTCGATTCTGACTGCCTGAACAGCAATATCA
TTATGAAAAGACGAATGAGTCCGTGACCTAGAAAAACACGATAACAACAAGGTCAGCGTTGTGTCCATTAGTAAATCAAAAGCGCGCACTTACTCTTGAC
TCCATTGCGGACATGTTCGTATACCCGATCCACCACTTCGTTTAGGCTTGAAAAGCTGTCGAGGAACAGCACAAACGCGACCACATCGGCCAAATCGACG
TCCATCCCAGTAACCAGGTCGCGAATCATTCCGTCAATAGAACTCGAGCGTACAGACCGTGAAGCGTGGTCATCCTTGTCTCCAATCTTCCACGAGTCGT
TAGGCATTAGCGAACGCAGAAATCCCGCCGTTTTGTTTACCTCGATATGGTCAGTGTAGTCAGCAGAAGAGCAGCCAAAGATGTCGACATCAACGCCATT
GCCTCCCCGATTAAGCGATCCCAACTTTCGCAGCAATTCGACCACGCGAAAATCTCGCGAGATGTTCGCTAAGTGAGAAGCTTGGCGGCCAAAGAGATCT
CGTTGATCGAGATGACACCCAGCGCACGTCAAGATCTCCAGGCACAAGATTCGGGCATCACCACTTCCGTTGGGAGCTGACGCAAGCAGAATAGTCGCTG
GAGTCTGCCCACACCTGTTCTGGATGTTGGGGTTCGCACCACCCTGCAGCAACCGGAGAATGATATCGGTGTGAGCCAGAGCGGCAGCTAAGTGCAGACT
GGTGCTTCCGTCCAACGTAGGCGCGTTCGGATTTGCGCCCTTCGAAAGACAAAGCTCGACAAGCTCTGTACGCCCGCTCTTTACTGCAAATTCCAAAGCT
GAGAAGCCATTTGACCAAGCAACACGATGGGCATCAGCTCCCAGGGCCAGCAACGTCGCTGAGCCTTCAAGAGACACTCTGGAGCACATGAACATCAACG
GAGTGAGTCCATGTTTCTCTGCTGCATCGATATCCGCTCCTGCATCAATCAGACTTTGGATGATCTGAGCCATGTCGATCGACTGCTTCACAACGTGTAG
TGGTCGTCTTCCTTTATGGTTGCACAGATTGGCATCTGCCCCCTTCGAGATAAGATAATTAACCATTCCGAGTTGTCCATTGTGCACAGCAGCATGAAGC
GGCGAGCCCTTGCCGGATGCTGGAATGAATCCGAAAACCTGCTTGCCTCGAGTCTTTTCCCACGAGCAAAGAGTGTTCAATTCCACAGTCGAGGATCGCA
GCCATCCAGCCGAGTCCAAGTCTCCACGACGAGCTGCAATGCACGTCAAATAGCGGGACATCTCCAAGTCCAGTGACAACAGCTGATAATAGTAAAACTC
CGTCATGAACGTAAGTTGCTTCGGCAATGCTGCAGTCCGAACGCGTTGGATAATTTTCTCGAAAGGCATTCCAATCACAGGCTCACGGTTAATCGCGATC
AGCGACAATCCAGGCACGATGGCAGCGCTCAAAGCTGCTTGAGACTGCTTCCGAACACTATAAACAATAGCTCCTCTTCCATTTCCGTCTGTCGTGAGCT
GAATCCCAATATCGTTGGTCGAAATGGATACGGAGACACGAGATCCTGCCAGCGCCATCGTGTCGAATCGGTAGCTTTCATCTCCAGACTCAAAGTTCTC
AACCCATTTGATCGCATCGAGAAAAGCAGTCACGACATTCGCTTTATTCTGACATGCTGGGTGGTGCTGATATCCATACTTCAGTAGTGCTCGAAGAATC
GCTAAGTCGCTGAGCGAGGACATCGTTACCACGTACCGGAACACCGCCGTCAACGTCTCGTCTGTGACCTCGAAGAGCTCGCCATTATACTGAGCAATCT
CCTCTGTGACGGTCTTCCCGGCGGACAAAATGACCTCGAATTTGTGCGTCGGCAGCGACACAGAGTCGAGCATATTGATCACACTGATAGCTTGCTTCCA
ATTGCAAACCGACAAGTCTTTCGAGATGCCGAAATCCGCCTGTGCTTTCTGTTTCAACACCTTAACGTTCTGCTCCAAGTTGCTCCGTCTCGACTTGACT
TTATCCGTCTCTAAGCTCGCGTATGCCTCCGCATACAACGGAATAAACACACGGTCCTCGACATGTCGCCGAATCAGTCGCACGAGCTCATTACCTGGCA
ATAATTCAATCTCTGGATCTTGATAGAGCTCCAAATGGTGACGATCGATGATAGAGTCGTCCAATTCCACGATGAAATTGTGGATTGCAGCGTACGAATG
GTCGTGATCATTTTCCTTGAACTGGACCCAGTTTTTAGCCACCTCTTTGTCCGTGATGAAGATCTTGTTCAAGAGTCTGGTAACTGCATTGGATCCTGCT
TTCTCTTCGGTCGCAGTCAGGTCCATTTCATAACAGGGTGGAGATACCCTCCTCACTGACCGCAATGCAGCGACCCACAACTCGGCTTCAAACTGGCTGC
AGCAATAGCACAATAATTTGTAGAAACCTTTCTCGATCTGGAACACATACGCTTTACCAGCTACTCGGATGTCCACGTGCTGCACGGAAACCACGCCGTC
GTTTAGTTGCATGCAACCTTTGATCTTCTTCCTGCCCTTGTTCTTGTAGTAGGCAAAAGTGCCATCCGAGAAAAGCACGAAGAAGCGCGTCTTCCAGCTC
TTCCACATGTGTCCTTGTTTGGTGAGCCAGCCCATCTTGACGAAATTGCCAACCTGCACTTGAGTGGCGTAAAACGAGTCGTTTAGGAGTGGATCGGAGC
CGTGACGCACCAGTCGGAAACCTTTATCTCGCTGGACGAGCGCCTGTGGCGCCTCCGTGGCGTCCGATATGGAGCGCGATGAGCGCGACAGTGCTCGGGT
TCTGAACATGGAGGCTAAGAGGCTGCGACGTTTGTCACGGTCCTGTTGTTCGGCAAATTCTTCAACTTCGAGCTCGATGTTCTGAGCTTGGTGTTGCGCT
TGGCTTTTGGCGTGTGTGCTGCGACGTGAGAAGCGGGAGCGCTTGCTGATCTTAGGAGCCGTCTCGTCGAGTAGTGGAGGAGGCGATGGAGACCCCCACG
GATCCAGGACGGCTTTGGTGCCTTTGTGGCGCCAGCCGGAAGCCATCGCTTGGGTAACTTGGTCAACTGCGGAATGGTATGCGACTCGTCACTGTGGTTC
CCTATTTTTTAGTAGCGGAAAGCAGCTGTTTCTTGTTCCACCTTTGACGATACATGCATAGGGTTTTGTGGGACGGAAATGAAAATATATTTGGAAATCT
AAGGAAACTGCACTGTGTATTACGGATCAAATGTAGAAAATCCAGCTACCTACACTTTTTCCTGCGTTGGACTTTGGCTGTTCGATGTGCTTCCAGCAAA
CATACGTGCGAGCTTTGGCTTTGAGATCACGATACGTAGCTTTGCGGTAAATGACGAATTGCTCGTGGTGACGCCACAGGCGTAGCCCGTTGTCCAATAC
GTTTCAAAACCACAGTGTTGCACAACACGTTGTGTGTATTAGAATAGATGCAGTGGCTCGACGCAACGGTGCGTTTGTTGTAATAAGCGTCGCTACGATG
TACTTCGAAGTATACTGTAAAACGAAGAGCGACGCCTCGCGCAAAGCTCGAAAACGTTGGGCTGAGCCCGTGTACAGGAAGCTTGCAGTGCTCAATATTT
TGTGCACCTATTGACTCACTTCGA