Description :
From Genome Similarity Track
Location :
Scaffold_15:138447- 142169
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_05172Urease accessory protein UreF
Sappa_CBS223.65SPRG_05173Hypothetical protein
Sappa_CBS223.65SPRG_05174cell division cycle 5-related protein, putative

Sequence
3722 bases(100 bases per row)
GCTGCTGCGCGTGGCGACACAGACGTACTCGCACCTCCCTGTCCTTCGCGCGATCAAGCAGACGCGCCCTGTGGGCCACCACGTGGTCGTGCTCGGCACG
CTCTGCGGTGCGCTCGGCCTCGACAGCCTCGCGAGCCAGCGACTTCTTCTCTTCTTCACGCTGCGAGACATTCTGAGTGCAGCGACGCGGCTGAACCTCG
TGGGGCCCATCGAGAGCGCCAAGCTCCAGATGCAGCTCGCCGAGGTCGCCGAGACCGTGCTGCAGACGCGGAAGGACCGGCGTGTCGACGACGCGTACCA
GTCGGCGCCGTACCTGGACCTGGTCCAAGGCCGCCACGATCAGCTCTACACGCGTATCTTCAACAGCTAGTAACTTGCTAATCATCGACTAATAACTACT
GCTCCGAGCAACAGACGCTAGCGATCGCACGGCAGATGTGGCGCCAGAGCTGGAACTCTTCTGCGATCACGCGGAGGCGAAGGTCGTTGGGTGTCACGCA
AGTGGCCACCGGACGGGCGCGCCGCCGACTGCGCGGGTTGGCCCACGTTGCAGTCGTACTCGCAGTTGTCGAGGATGGCTCGGCGGACTCGAGGTCGCGG
GCAGTCGCCACGAGGCGCCGAAGCTGGGCATTGGCCTTTCCCACAAGTGCCCAGAAAGGCGACGTAAGCGCTTCGAATTGCTGTGCCTGGGATGGCTCGT
AGCGCCGCATGTGGCTCAGCGCTGCTGCACCCAGCGACTTCTAGTACAGTGCGCTGTAGCCTTGCGTTTGAAAATGGAGCCCAACCTTGGCGACGAGCTG
CGTCTCGAGCTCGAGCGCCTGCGTCGACGCATCTCGTAGCTGGATCAGTTGCGCACGTTGCTGGAAGAACGACTCGATGGTCGTTGCCATCCACTCTTGG
TCCTCCTACGTACGACAAGCAGCGGATAAAGGAAAGCGAATATGATGCCAATGTCTACCAGTGTCGTCTCGGCCGTTGACGGCAAGAGCTTGAGCATCTA
CACACGTTGCGCTGCATTCAGCAAGAGAACACCTTCGACCGTCGTACCGTGAGGCTGCATGTGACAGAGTCTTTCAGTGCCTCTTCTTGCCCATGTAGAG
AGGCGACCCACGACCCTCGGAGCGCCGATACCTTGGCGCGAAGCGTCGGCGCGGAGCTGATCTGGGACGCTACGTTCATCCATCGTGGTGCGTTGTCCAA
GCATGATGACGTCGTACGAGTGTTGGCTGCGGCGAGCTGCTCCTGTACGGCTCGAATGTGCACGACTTCCTTGCGCAGTGCGTCCTACGCCGCCATTCCA
GTGTTGTCGTTGCAGGTGTTGCAGTGTACCTCGACCGTCAACGGCGGCAGCTGAAGCGCCTTCCGCACGGACTCTTCGAGCACTTCCATGAAGCCGCAGT
GCCAACACACGAGCAGGCCCGCACGGCCATGGTTGATCGGCGACAGCTTGTGGCAGACGTCGCATGGGTAGGCGAGGCCGAGGCAGCCGAGGCTAGCAAA
GACATCACGCTGGCATCGGATATGCGGATCAGAAGAACTAACCACTGGACTGCGTACTCGAGGCCATGCATGCGCAGTTCTGCAGGAACCTCGGCGGCTG
GAGGTACGCTCGTCGCGATCCCGCAGGCCGGATCCGGGCAGACAAAGGGCATGTTTGAAATTATTGCATCCAACCGAACGCGATCCAAACCGGTCGGCTA
ATCAGGAACGACTAGCCGTTAAGAAGATCCTGTTTAGGACAATGCCTTGAATCCATCAAGGCATTTGAATCTATCTATCTAGGAGTGAAGCGCGATAACA
AGACTTGGTCCGGAAGCACTCGTAGGATAGCAAAGGCGCAAGCACCTCGCCTTTGCGCTTCTTCGCAGCTGGCTCCCTCGTAGACTGAGCAGTGTTCAGT
CTGGAGTGGGCGGCTCGTCAAGGTGCGTGCAATTAGATTTCGGTCCTCGCAATATATTTCGGCAAAGTCCTTGTTTCATATTGCCACATTCTGGGACGAG
CGGTTCCAGGACGCCAAGCGAGCTACCATGCGGGTCATGATCAAGGGGGGCGTGTGGAAGAACACCGAGGATGAGATCCTCAAGGCCGCGGTCATGAAGT
ACGGCAAGAACCAGTGGGCCCGCGTCGCGTCGCTCCTGGCGCGCAAGTCGGCCAAGCAGTGCAAGGCGCGCTGGTACGAATGGCTGGATCCGAGCATCAA
GAAGACCGAGTGGAGCCGCGAGGAAGAGGAGAAGCTGCTGCACTTGGCCAAGCTCATGCCGTCGCAGTGGCGCACGATCGCTCCGATTGTTGGCCGGACG
GCTGCCCAGTGCATGGAGCACTACGAGAAGCTCCTCGATGCGGCGCAGTCCAAGGACACGGAGAACGCGGACGACCCGCGCCGGCTGCGCCCTGGCGAGA
TCGACCCGAACCCAGAGAACAAACCCGCGCGCCCTGATCCGATCGATATGGATGAAGACGAGAAGGAGATGCTGTCGGAGGCGCGCGCACGTCTCGCCAA
CACGAAGGGCAAGAAGGCGAAGCGCAAGGCCCGCGAAAAGCAGCTGCAGGAAGCGAAGCGCCTCGCTTCGATGCAGAAGCGCCGCGAGCTGAAGGCTGCG
GGGATCAACTTTGACCGGAGCCGCGAGACCGGCACGGTCTTCAAGGTCAAGCGGCGCAAGACGTACATGGACTACGTCAAGGAGATTCCGTTCGAGAAGA
AAGCGCCCGTCGGCTTCTACGATGTGAGCACCGAGAAGGCCACGGCCGGCGGCGCGCTGGACCCGAAGGCGGCGGCGCTGTACCTCGATAAGCTCGAGGG
CGTTCGTCGCGACGCGGAAGAGAAGAAGAACCGCCGCATGGATGCGCGCCGCCAGAAGAAGCTGCTCACGACGTCGCTGCCCCAACAGATCGCGGCCATG
AATGCGCTCAACGACCCGAGCACGATGATCAAGCGCAAGCCGCTCGAGCTGCCGGCGCCAATGGTCTCGAACGACGAGCTCTCGGCGCTGGCCAAGCAAG
GCGCGGAAGACATTGCCCACGCGCAAATGCTCGCGCTCGAACACGCGCAGTCGACACAGGCGCTCTTGACCAACTACGAGATGACGCCGCAGCAACATGC
CACGCCGGCGCGTGCGACGGCTGCGAGCTCGTCCCGCGAGGCACTGCTCCAAGAAGCGGCGAACCAGGCGGCCTTGGCACGTGCGCAAACGCCGCTGATG
GGCGGCGAGAACGTCGAGCTGCAGGCGGGCACAGGCTACGGTGGCATCACGCCCCGTAGCAACCTCATCAAGGCGACGCCGCTTGCATCGGGTCTCCGGA
CGCCGCAGTCGTCGCTTCGGACGCCGATGCGCGACCAGCTTGGCATCAACGCCGAGCCGCTCGTCGGCCTCGACGCGTCGCGCAAGGCGGAGAAGGCGCG
CAGCCGCGGTCTCGCCCAGGAGCTCAAGATGGGCTTTGCCAAACTGCCGTCGGCCGAGAACGAGTACGAGCTCGCTATGCCCGACATCGTTGACGACAAG
GAACACGCCGAGACCTTTACCGAGGATGCCAGCGAGCGCGAGGCCCGCTTGGCGGCGGCGGCGGCCAAGGAGGCTGAGAAGGCCGCGCTGCGTCGGTCCA
GCGCGGTGCAGCGCAACCTGCCGCGCCCGCTGCACGCCGAGAGTACGACGCTGTCGGCCCTGGAGGGTCCCGCGGCCGACGAAATGCGAGCGCTTCTTGC
GTTTGATATTGCGGACAAGAAG