Description :
From Genome Similarity Track
Location :
scaffold_5:13842- 22556
Transcript NameFunction/comments
g8100.t1hypothetical protein
g8101.t1 hypothetical protein PHYSODRAFT_477622
g8102.t1 cyclic AMP-dependent protein kinase-like protein regulatory subunit

Sequence
8714 bases(100 bases per row)
CCGATAGCTGGAAGTTTGAGTATTTGACCCGACGACAATGCCCTCCGATCCTCGACGTGCTTCGAGAAAGACTCTGATCTTCCATCACAGATCAGCGAGA
CCGGAATCTTCCGATGCAGGCTCAAGGTCTGCATCGCAAAGACATTTAAGCACCAGGCCAGCAAAAGGTCTACGAGTTTTCTGGAGACGCAGACGAACTG
TGACTCCTGCAGGCTTGCGTTCGTTTGTTGTTGCGGAGCATCAATCATCAACTGGGATAAACTCAGCTACACGTCGGTCTAATGATCCCAACGATAATAT
CGTCTTCCTGAACAACCCGACAGAATTTGATCTGCGCTCCTATTTGTTCAAGCGGCGAAGATCAAGCATCGCAACAGATAGACTCGAGAGATCGGTCATC
AGTCAACGCTCTATTGGCAGCAGTCGTCGCAGTCACACGCCCGGGATCACATCGACAGGTTCATTCAAAGGGGAAGCTCTCTTTGAGAAACGAGCAGAGG
TGATGATCTCTTCTGCAGATGCATCGATCGCAAAACAAACGGGAAAACCGCGGCGTAGGCTACGAGCGAAGGAGGAATTATGCATCGTACTTCCTCGATC
CACTGCCCGTGGCCGAACGCGGTCTCAGAAGTCCTGGTTTCTCGGACCAGGATTTATTGGGTGCGACCCAGGAGAAGGCACGCTCGTAGTGACAAAGGAC
AAATCCATGGACGCAGTGCATGCCGAAATCTCTGTAGCAGGGGACGACTACTTCGTACAGGACGCTCAGAGCACAATGGGTACTTTTCTTTGCCTGAGTA
CACGCTACCGACATTATCCACAGAGGGATGGTTTCCGCTTGTGCCATGGAGACGTCTTCCGGATCGGACCGGCTACTTCAATTCGCGTTCTTGATCTGCA
AACAACCACTGAGACAGCTCCTATCCAAACCACGCGGAGCCGCTCTAGTTCTATCGCCAGCATTACAACCACAGCAGCAGAACAGTCTGCATTAAACTCT
GAGAGCAGTACATCTCATACCCCCAAGCTTGAAAAAACTGCAAGTGCCAGCAGCAACAGCGGTGGAAACGCACAACCAGGTTTGAAACGAATGTCGACCG
TAGAGGAACTTCGACTTCTCGCTGCTGATATTGAAGACGAGCTCATGAACGATGTCGGTAGAATCCATCCAGGAGTTACACCGCAAAATGAAGCCGGCAA
CATCACCAAAGATGACCACAGAGGGGAAATGCCTGCTCAATTAAAACCGCAGCACATCGTTCACTTTGCAGATACGCCCCCAATGATGTCGGATGGATCC
GTTTTCTTGGGTAGTCGCTACATACGTCCAGAAGTGAAGGAACTGCACTACTGTGAACCATCCCAGGTAGAAGATGCTGAGGATGATACAATCAAGCAAC
TCGTTGGAAGTGAGCACGAATCACCACCAACAGAGTACGCTGGCTCAAACATACGCCGGGCTGCATCGATTCGCCTCGTCATTTTCCAACATGACTCTGC
TAATGCCAGTACAGAGCCTTTAAAGCCGCGTGAGGCTCGCGAAGTGACACTGACTGGCCAAGGAACGTATCTCATCGGCTCCTCAGCTGCTTGCGATGTG
CGCATTTTTCCGTCGGAAGGTATTGAAATCCGTGCTGTGCACGCTCGGATTTTATTTGACGGCACATCGTTCGTGTTGCAGGACGTATCATTTGAGCGCG
ATCCACGTCGACAAACACGCGTTTTACTCACCCAAAGACCCGTGAGAGTTACACGAGGCGATTGGCTACTACTTGGTAAATGTGCGCTGTACATCACGAC
CGTGGCCAGAGCCTTTGGCTCGGTGCGCCGTCCAGATATGAAAGAAGCAGCCATGCGCTTGGACGTTTTGAGACTTTCAAAGCGAAAGCCAAGGACACGT
GGTTTATTCGTGCCCGTGGGGTTTCGATTGCACTCGTCATCAGGCTCCGGAGCGTCTAGCGGGAGTAGTGGATGGGGTGGCAGCAGTGGCGGGCCTGTCA
CGTTTGGCAAAGGGCGAGACTGTGACGCACAGGTTTTCACGGCGTCTCTAGCGACCGAGCAATTCAGCGTCCAGCTTGAGCGGGGAACATGTTTGCTCAC
GCCTAAACCAACAGGAATCAACGCTGGCACATACTTCTTGATCGGACGTGATGAACCTGGACAGCCATTCCTCGAAGATGGAGGCTACAACTCGAGCGAC
ACGGAAGAATCCAAATTCGAGGTGGTCAAACATACGAGCAAGCCTCTGCTGCTATCGGAAGGGTGTGTCTTCAGGTGTGGCGGGTGCGAAGTGGAGGTAA
TCTATTCAAAAAGCGCGACTGCATCTGATTTGAAGAGCACTGCTGCTTTTGAAGAGCAAGAGCACATCCGGTTCTTGAGTGGCATGCCATGGTTGAAACC
AATAGTCTCCGACTTGAAAACCATTACGAACGTTGCACGCTGCGGCCAGAGATTGAAATTGGGCCCGGGGGAGTTGGTATATGAGAAAGGTGACGCAGCA
AATTTCGTGTTTATCGTGATCAGCGGCGAGGTGGCGCTCCATATTACCTGTGCGAACGATGAACAGGAAGGGGATGACTCGGAGATATTGACTGAACAAG
TGACTGCCGGCGGATACTTTGGAGAGGTGAGTTTGTACGACCCGATGGTACTGTACGCTTCCGCACCAAACTGTGATGGTCATGAGTATCCTGAAACTGC
GCGAGCTGCTAGCGCTTGTGAGCTGCTAGCATTGGCTAGAGAAGATGTTTGCGGGTATCTGGGTTTGTATATGGATATTGTACGCGCTCATCTGCGCCAC
GATCAGTGTCGCGACAAGACCATCAGACTGGCATGCATTTGTGTGCCATGGCTGCGGGGGATCTCCCTCCACGAGATGCGCTTTCTTTCATCACAAGCTG
AAATTGCTGTGTATCCTCCAGGATCGATCCTGTTTGAGGATGGAAAACTTTTTGTCCCCGCTGCTTTTGCTGGCGGAAACACATTTCAACTGCGGGATGG
GTTTCTCGTGCTCATTCGTGGGGATGCCCGGATTGTCAGAAGTAAACAAGAGCGACAATATCGGCGAAGCAGAAAAATACACCAGGCAGAGGATGTTGAA
GAAAGAGATTTCGGCGACGTCGACGAGGAACCAGAACAGGATCATGACGAGTGGTGGAGCCCAATGGAACCAGTACTTGCATTGAGCTGGAGCTCGTCTC
CGTCTGTGTTGAGCGTTTCTGATCTGTCATTTCGTCTGGAAGCTTGCTCCACCGTTGAGTGTTATTTTGTTGCTGCGGTGCATCTCGCCCATCTGGATGT
CGATATCGGAACCAAACAACAGCACACTACCTCTTTTGGGCCAGAGGCGTCTTCTGTCGCCCAGGCTCCACCACCATTGAAACGAGTCCATTCGTTAGGT
CCTAGGCGAATGCACCATTCGCAGGTCGTGACCAGCGCTTTGCACAGTGGTGGAAACAGTCATGGAGACGACGATGACCATAACTCGTTGGACGGGTCCG
ATGGAGAAGGTGATAACACCGCAGCTCGCCGATGGAGACGCAAAAAGCGTAACAAGCATCTTCTCGAGCAGACAGTGCTGGAGACGCAAAACGACGCGAA
GATACCAAACGCGTTGGTATTATACGTGCTGGCGGGGGCTCAGAGAGGGGATATCCACGTGGTTCGCAACGTGGCATCAATAGGCGGCTTTCTTAGCGGA
GCAGACATCGAACTCAACGACCGGTATATATCCCGTGCACATGCCGTTATTGAATACCATGAAGGCAGATACTGGTTGTACGACAACTGTAGTAAGTGGG
GAACCTTCGTACGCCTTGAAGAGGAGAACGCCGTCGACATCAATCCAGGAGACGTCTTTTTGGCCGGCGAAGTTGAGTTCACGTGCCTCACGTCGTACCC
GGAGCGAAATAAACCCAGCATGTGCTGTGTAATGTAAGCCATGGCGAACCAGGCCGTGAAAAAGAGTAAATCGTAATGACACTGGATAGAGTACCAGCTT
GACCAGTGGCTTTATTCAACAGTCTTACATGACGCCAGAGATGAAGCAACCAGCACGTGCGCTAGTTCACTCGTTTGAATAAATTCCTGTCCTGATCGGA
TATCAACACAGACTGGACCGCTCAAGGCCTGAAGACCACCCACAACAGGCAAAAACTCGATCCAAACAGTCTTCGCTGTCTTGGCTTCTACCATACCAAT
ATTCTGTGGCATCATGCAGAGCCACACCAAAGAGATCAAAAATGTCAATCACTAGCTACCCTTTTAAAACAGCAGATAGTACTCAAACTTACCTGGTGAG
ACGCTGACGAACACACAATACCGTGCATAAGTTCCTTGCGGAACTGTAGTTGTAGTGCGAGGCTTCGAGTAGAGTTGTTGATCACCGATATAGGCACCAG
GAATGGTTGTCCAACCGCGACTTCCTTGGGTAGTTCCTCAACAATCACTATGACTTCGCTATGCTGCCCTGCTCCAACGCCAGCATGGCCGGAAGCTCCA
AGAGCTTTCCGCATAACTGGCTGACTCTGCACTGATCCTGCTTCTCCCATTGATATTTTCCACCCCACATGTAGTCGGCCAAGGTTTTGCGAGCCCTGGA
CAAATATACACAAAATAACATCTTTTAGATCGAAGAACTTCCCAATTTCGCGCTATGAGGCATTACCTGCGCTGATAACAACGTCGGGTCTGACATGGGG
TCGTACGATACACGGAACACACGTTGCAGCTCCTCCTGCGGGTATACAAGAGTCTGCGGGCCATTTGTTGCGAGAAGGTCCTGAACTGATAGTTGTTCTC
CATCTGCCTTCTTACCAGCAACGTGCATCTCTTCCGATGTAAACGGCGGCAAGGGCAGGAATTTGATGCTGTCCACAAAAAGTGGCAGTTTGGACACATT
ACGGATCTGAGCCTCAACGATAGCCTCGCCCTGCTGCTGCTGCTGGTTGTTAGCTGCCGAATTCTGCTTGAACGTGATCACCAATGGGTTCTGCACTGCA
AACCGGTAGAATTTGCGGAGCGACTTGCTTTCGCCGGTCACGGGGTCCACGTAGGTCACGCCCACCCGTAGCACGTGGTTCCCCACCTGATTAAGCGGAT
AATCCACTACCATATCTAGACTGGAACCTGCAGGCAGCACAGCCACAGGATTCGGTGGCGGCAGTTTCCCCGTCCTCGCGTAGCGGTTGTCATGAAGCTC
TACCCGGTCGTTGGCACATTGGATGTTGGCCGACAGCCCGACGTCCCGCAGCTCGCACGAGTACGGGTTGATGACGCTGATGTAGCTGCTGAAGGTGTTG
CCCAGAAAAATCTCTCTGTCATAGTAAAATGCATATAAAACATATTACAAGTAAGACACATCATCCCAAATATGACAATGAAGAAGCTTTTGTCGAACCC
GAAGCTGTCGGGCAGGATGAGCATGCTGGACAGCGCGAACTCGTGCTGTGTGGCGGTGACCTCGTCCAGGGACGCGGGCAGCATGGAACCCCCGGTAACG
CCCTGCGCGTACAGCTTGGGCTTGTACAGTCGCATCACTAACAGACAACAAACAAGAAAATCGTATCAAGAGGAATATTTCAGATTAGAGTACAAGAGCC
GCAGAAGAAATAGACTGCCACCTTTGAGCGTGGGCTGCACGGACGGAGAGGACGCTGGCGGGGTGCTCCCGCCGCCGGAAGAGGGCGGGCCGCTGGTCCC
GTAAGCGGAGCTCATGATGAAGGAATAATGGATCGCAAAGTTGCGCTCTCAGAATTATGTTGCTCTATCATTTGCGCACCGTAACGTTGCTATGTTGCGC
TGGTATTGACCCCTCATTTGCTTTCAGAATAGAGGAAGATGCTTGCTCGCTCGCTGTTCCGCGCCGCCTCGAGCGTCCGTGCGTCGCCGTCGCTGGTCGC
TTCCTTCGCCAACGTTGGCGCAATGCAAGTTGCGCGCTTCTCCGACGCCCCCACGGTGCGATTTGTCTCGAAATGTGCGTCGAATTACGTGAAAACTCTC
GTCTCAAAGGTTGTTCATGATGACTGCGTAACGTTCAGATGCACGGCACGACGATCTTGTGCGTCCGCAAGGGAGGCAAAGTGGTGCGTTGGATAGAGCG
GAGAAAAGTGCATCGCGTATGTTAACTTGGCGAAGAAGGAGGGCTAATTGTTGCTGTAGTGCCTGATCGGAGACGGCCAGGTGTCGCTGGGCAGCACGGT
GGTCAAGCCCAACGCCAAGAAGGTGCGTCGCATCGGCGAGCACATTGTGGCAGGCTTTGCTGGCTCCACGGCGGATGCGTTCACGCTCATGGAGCGTCTG
GAGGCCAAGCTGGACGAATACCCGGGACAGCTCACGCGGTCGTGCGTGGAACTGGCCAAGGCTTGGCGGACGGACAAGTACCTGCGTCGTCTGGAGGCCA
TACTCATCGTCTCGGACACCAATCAGTCGTACACGCTGACGGGCAACGGAGACGTGCTGGAGCCGCACGACGGCATCATAGGCATTGGCTCGGGAGGCAC
CTACGCTCTCGGTACGTGCAGCCTGGTGTTTAGTGAGCTTTTTATTGTTATTTTTGTGGAGATGATTGACAGCGCTGTGTTGGACGTTGTAGCCGCTGCC
CGTGCGCTTATCGACCAGGACCTGGACGCCGAGACCATCGCTCGCAAGTCCATGAAGATTGCCGCCGACATTTGCGTCTACACGAACGAGAATGTTACTG
TGGAGATGCTGGGGGAGGGGGAGTCTGAGGCCAAGACTGACAACAAAGAGTAAGATGAGGTAGAACAGGTTGCACCGAGGCGTGTAATTCGTCAGCAACG
CTCGAGTAAATACAAGGTCTGAGCTGTTGAGTTGAATCGCCTAACCATTGCAAGCAGAACGTAACCAAGGCACAATGGCGTGTCTGAAAAATATGAATAT
GATAGTCGTGGTCGGGCAAAGGAAGACAAAGAGAACGCTAACAAACGTCACCGAAATGACTGCCATCGCCGTCTGCCCCGTGAATGCAACGCCAGCATCT
CGGTTGTCAGTCACAGTCCACAGTAGTGTGGCACGCGAGGTGCCAGATGTCCTTCGTCCCTCGTCCCTCGGAAATTGTGATGGTTGAAGGCGTGTATAAG
ATGTAGTATTGGTGCGCGTGTGCGTTTTCCTTTTCCTGATGCTGCTTAAATGTTGTTGGCGATGACCGAGTTGTACTTGTCGATGTTGCGCTTCAGAATG
TCTTCTAGCGGGCCCATAACTCTCTTGAACGTTTTACGGTCCAACGTGAGACACTTAACCTTGCCCTGGGCGGTCACTGTTGCCTGACGAGGCCGAGTTG
TGAGCAGTGCGATTTCACCAAAGTACGCGCCGGATGTGAGCTGGCCCATTTCCACTGGCGGGTCTGCGGGCGAGAGCTGCTTCGTGCACACTGCCGAGCC
TTCCTCAATAATGTAAAACAGGTTGCCGTCGTCACCCTGTGCGATGATGACTTCGCCATCACTAAACGTTTCTGTCTTCAGAGCGTCTGCGACTGTGAGA
CGCTCGTACTCGCTGAGCGACTCGAGCAGTGGTACACGCTCAATGAAGCCCTTGTGGGCCTCGCGTTTCTTCAATGTCGTTTCCATGATGATAAACTTGA
AAGTCTGGCGATCTAATGCCCACGCCTTCGAGTGCTGCACTGCTTTAACGGTTGCTGCTCGCGGAGCATTGTACATGAGGGCCAACTCGCCGAACGACAT
TGCTTCAGTGCACTGCATCAGAAGACAAAAAACATGAGCACCCTGCCACTGAAAAAAAGCCAGAAACCCCTTCAGTAGTGAACCCACCGTCTGTACGAGA
TCGCCGTCCTTGTAAACTTCACATACGCCGCTCTCCAGAATGTAAAAGTTATCTCCGTCGTCACCCTGCTTGATGATGGTGTCACCAGGCTCGAATTCCT
TGGGGAACATGGCGTCGAGCACAATTTCGTGCTGCTTCTCGTCCAGCGACTTGAACAAAATGTTCTCCACGACCATGCGACTGATGCCCTCCCGCTCCTC
TGTAGACTTGGGGTGCACCACGCGCTCAAACTGCCGCGCACTGCCACGTCACACCAAGTCAGTTTACCATCAGACAGGACAGCGCCACCTCATAACAAAC
TGCTCACCTCAGCGGGTCAATGGTTTCAGCGGACACCGAAGTGCGCCGTCCCTTGGCCATGATCTTGGGCGGCGGCGCGCTGGCTGCGATCTCGCCCACG
GCGTCTCCACCCTCATCCTCGTCCTCGCTCTCGGACTCGTCCGAATGATCTGCCAAGAAAATGCACATTAGATCTCCATTCTCTACCATTAGGTAGTGTA
ACTGCCCACGACGCACACTGCACGTGGGGCGAGGCGGCTGGGTTGTCCTCCTTGGCCCCAGGCTTGCGGCGAGGTGTGGCCTCCTCCGGGTAGTTGGTCT
GCAGGTACTGGATGATGTGCAGGATGGGGTTCTCGGGCTTGGCCAGCAGCAGCGACTCGACGAGGTTGATGAAGAGCGTGTTGATGCCCTTCTTGTGCAG
GTAGTCCTGCAGCTCCTGTTGGACGCCCTCTGCGTCCGTCATGCTCCTGTGCGGCGAGTGTCTGTCTTGCGAGTGGCTAGCTGGATCCTTCCGTCTCGGG
CTTCTGCGTGGGCCTGAAAACTAAACTGAGCCTGGCGTCACGGGGCCTTCGCTCCAAAATGGAAGAAACCCCTGCAACAGACGCTGAACCCAAGCGAAAG
ATCGCCCCTTGTCG