Description :
From Genome Similarity Track
Location :
Scaffold_1115:1384- 10561
Transcript NameFunction/comments
Phyag_g9549hypothetical protein PHYSODRAFT_474392
Phyag_g9550hypothetical protein PHYSODRAFT_349422
Phyag_g9551hypothetical protein

Sequence
9177 bases(100 bases per row)
AACATCACACGATCGATATGACCACACTTTTGATATGCACGACGTACACTTTCGGAGTATTTGTCGCCTGGCTGGGTCTGCTCGGGCTGGTCTGCGATCT
TACGTATGATCCCCTTCGCGATCAGCTCCGATTTTGAGCTCTTGGTGCAGCCTTGAGCTACGAAATCAAAACAACAAGACACGGTTCGCAGTGTGGCACA
ACGTCTACAGGAATTTGTGCAAACCTACCTGAGAAGAAGGCCCAAATTGCCTCGGAGATGCTGGCGTAGTCCACTGCCCTTCGTCCTTCCGCGTCAACCA
TCTTAGGGTCTGCTTGGTTGGCCAACAAGATGCGCACAACCTTGCCGTGTTCTTGAAACGCAGCCGCGTGTAATGCAGTCCACCCTGTACCTGTCAATAG
CGGAGGAACGATACCCAGTAAACACTACAAAGCGAAAAGTAAAATATAAGTACTTGAACAGCACACCTTCGTTTCTAGCGGATACGTCAGCACCTTTGTC
CAGCAAGTATGCAACCATACTGTCGTTTCCCCACAGCGCCGCGGCGCACAGCGGTGTCGTTCCATCTGCCAATTTACACAAAGTCGTATTAGTTTTACCC
GCATAATGCTTGTTGCGTCGGGTTTCAACCTTTTCCAGGCGTATCAATCTGTACTCCGTTGTCCAGCAAAAACTCCACCTGGCGCAGAAACGAGAAACCA
TGTCAGAAGACTTGCCACCGTCAAACCGCAAATTATACACATACCATTGCACGGGAGCCATTAGCTGCTGCCTCCGCAAGGTCGACATGGGATCGAATCA
CTCCTTCCTGAGCTTGTTGGTCTTCCGCATCCGACATGGCGTTGCTTGAGCTGAAGCTTGGTTATCTAGGCACTCGCAGGGTCTTCTTAACAATGAACAG
CATCGCATTTGGAAACGGATTGCGATGCTTCGATTCGAGGCTGGCACAACTCGAATGATCAAATAGATTAGAGAAGGGTCCCCCATAAGTATGTTACGAC
GCCGTCAGATTTTCGAGGCACTTGGCTATCGACACCCGATACACATTCGTGCCATGCATTGTCGTCTTGCGCCTTGATGAATTGTGGAGGTGACGCTCCA
CGAAGCTTGGGTCGACAATCAGGTTtccagcgacgtcgagtGAAATTTCAGTGCCCACATGTTGGTACAGTCCCCACTACGATCAAAGAAACGAAGTAAA
CCAGTGTAGCGTTAGTTTGACATTCACCCCTCGATAAAACAGTAATGCGCGTGTACGTACAAATTTCGGCCACCCTGGCACGATATCGCCGTCCATGACA
ACGCGGTAACTCATGGGGACGCAGCTATCGTAATGTTGACGGAAGCTTGGATTCCCAACACGAGGCCCACCGAAGTTATACATGTTGACTTTGATGCTGA
AATTCACCGCAAGGTCGTAGGCTGCCAAAACTGCTAATGCACCACCCATGCTATGGCCAGTGATATACACCGACACGCCCGGGTTTTCGTCTAGAATGAG
CCGTGTCACTTCCCTTAACTCATCTCGAATGGAATCGTACGCGATCCAAAAGCCTACACAGCAAGCACAAGCATTAACAATAGTTGATCACACTCGTGGA
AAATTAAAAGCACTCACCTCGGTGTACCCGCGGTAGCGCCATATTCAGAACAGGGATCTTCGCTGCAATATCCTTAGCCCTTTCCATACAagttctcctc
cagcgaaGTCCACGAGACTTTATCCACAGCACATGTTGGTCCGCACGAAGATTGCTCTTCCAGTTTTCTTTACTCGTTGTTCCCCGGAACGAAATGACCA
AGCGTCggtgatcttcttggctcCATGCAACGACCACGTGGGTGTCAGTTAGGTTGCTTCTCAAATGAGTGATTAACTCGAATCCATGTCTCTCAAGCGT
AAGTTCGCCGTATCCTGACGATGAAGGGCATCCAGGGGGGTCAAAGTAGGCCTGGTACGCCAACTCTAGCAGCCATCCAGCCGTTTCCACGCAAAACAAA
TTCGAGTCGGGCGTAAGGAAGCCGTAAGAGTCCACACGTGGCTTCTCATCGACGTTGAAAGCAGTGGATGCCAGCAAACCAGTGCTGTCGCCCGCGAGTG
GAGGCAAATGCACAAACATCACCAGGTACACGTACACTGACAAGAACAGGAACTTTCCAAGCGAGGGGTGGCCAATGTGCATCTTTGCAAATGTGTGCAC
GGCATCCTGGATAAATGCATCGTAGCCGATGAAGTACCATGTTCGTGTCAGATAAAATATCTGGAGGGCTGACAGTACGAATACGTAGACAAATATAAGA
AGCGTCTCGAGCACCAGAAATCGGTACGATAGTTGCTTAAAGCGAGTGGCCATATACGGTAGACCCTTTAAGTGGCGTCCAGACCGCGCACCAACTACCA
TAATCCACACGAGCCAAGTCAAAATCAACCCCGTACGAACGAATCCAAGAAGAACATAGAGCTCTTCGTACTGAAAGTCATGCGCAGACGGCGTTCCCTC
GACTCCGAAAAATAACTTGGGCATTCGCAGTACTGTCATGCCAGTGTCTATGGCAAACAATACCAAGCCAAACATCATCTTTGGGGCAAATGCGCACCTT
CGAGACGAAAAATCTTTACCGTGCTGATCCATGAGACTCAGCCAAAACACGTAGAAAAAGGCTTCCGCGAATGACTGGCACGTGATCGACACGAATCGCG
TCCGCATACTCACGGCAGTGTACAACTCAGACACTGCATACACTGGATTTTGCCACAGCATGAGAACGACACCAACGCCCAACAACCACTTTTGTACGGT
TAGCACTTGGCTCCATGATCCACCGTGAAAATTCAGTACTGCAATGAACCAGCAAGGAAGCGCCAAAATGGATGCCAGTACTAACACTCCACGAACGATT
ACTTCGCCAACGTGAATAGCTGGCTTCCTGCAGAATATGAGAGCATCAACCTGTGAGCTTAGCGTCCAGAAtataataaaaaaaatatAGTGTAgagcca
acaacaagctgTACATACGTATACGCGAATTGATACACCACTTCTTTGCCGAAGACATTTGGATAAAGTCCTCTGAACGTTATAACGGCAAAGTAGCCGT
CGTAACCACTTCCACCCTGCAGAAACAACACGTTAATCAATGTGCATAACACTTAGATCCAACTCGACATCGTACCCACCAATCGGTCGACGTCTTGCGT
TATCTCCAGCACCCTCACAAGCTCACACGGTCCATCCGTTCGGCACTCCACCCAAATACTCCGATTGCGTTCATCCACTACAAGATCCATCGTAACTGGG
GTGACATCATGGTCAATACCATACAGTCTGGCATCATGCGTCAATACATATCCTGCTCCTTGGTCAACTTCGCCATCCTCAACCTCCGAGACActctcca
cgtcgtcatcTAATTTTTTCTTCACATTTCGATCCATTTTCCACGCCGTCCCCACACGTTGTAACTCTTGAAATGTATTGCTCTCCACAATTGAAGCCAT
CAACGCcgctgacgttgaagtgttcACCTGTTCCCGTACATCAAGCTTAATCTCAATAGACCCCGCGTACCGCGAGACATTGGCCACATAAGCTGTCCAC
TGAGCCACATTCCTCGTCTTGTCCACTTGAATACAGGGCTCTCTTCTGGTGTCATCCTTGCATACTTCTCCTGGTAATTCTACCGCCTATGTTGAAGTGA
ACAGAAAAAGCATTTTACATATTATAAAAAAGTAGAATCAGAATGTCAATTCCCTCAGATAGTAATATATGATTCCACTAAACATCACCTCACCGTTTCC
AAGTATCCTTTGCTCTGTAGATACGGCAGCGCCATTGCCAATAAgaacgccaagtacgtgatCCATAGCACCGCTGTAGCAGCTCGTGACGATAATGTCT
CGAGTCGAATCTGTGGCTCGAAGACATGGCGCTGTTTCTGATTCTCATCTGAGTCCGTGGTAATCTCTACCCCTAATAGCGGCGCAgtcgaagaagttgt
cgGAAGTCGCGAGTGCATCTCGTACGAGTCCCGGAAAAGCTCCGAAGACGCATAACCTGTGGACTGGAATAAGAGAGGACGATATACCCGGTCTTCTTCT
ACGTCTTCGTCCGCTGGGGATAAGGCAGAGGCCCCACGCTGCCGGTCGAGTGGTCGCATTCTGATCTGATGCGAAGAAATGATTTTCTCCGAGTTTTAGC
CAATAGAAATAGGGTGGTATCTTACGATCAGCGGATTTAGTGTAAGACacatcaagttgaagttgacttcAACTACATGGATAGCCTAGAGGAAGTTGCC
CCATTGTTCGTCTGGAGAGGGGGTGGTCTCGGCAGCTCGTGTTTGATCGGGTTGCGGAGTATTGCGCGAGAATGACGCCTTGCGGTCCGTGGGGGCGCTG
ACATCTTTgtggaagctggtggtggatcgCACGTCCGGCGCAAAGGTTGGAGAGACAGGAGCCATGGCTGGATCTTGCATAGCGAACGGCAGACCAGTTG
GCGACTCGTTCCCGGCAGCAATTGGCACCATTGGAGCTGGATCTGGAGTCGAAAAGTCGCCGATCGAAGCTGGAGGGACTGGGAAGGAGCCTGGAGTGTC
GACAGCGCTGCTGAGTGGGCTTGATGGCGTACCTTGGGTAGTGCAGAGCTGTATGTGGTCGCCGCAAAAGAGGAAGGCTGTATCCTTCGGCCACTTTTCA
AATTCTCGAATGTTTTCGCGGGTTGAGCGGACTTCCAACACACCTAACCAGCCggacgtcgaggacgaggatgaaggaTTCGTGTCGAGATTCATCGTCA
GTGATGCGACAACATATGACCCCCATCTAGTTTGAGAAAGCATTGCGATCTAGAGCACAGAAAGTCGAAAAAGCGTTAGTACAAGCTTCAGGTAAGCATG
GAGAGCAGCTAAAGAGGAAGCAACGTACGTGAAAGTGCATTGGTAGCTCAAGTAGCAGCTCGGGAACAGTTGCAATTTTGGCGTTCAAGACGTGAAGCGT
GTTCTGGCAAACCCCAAGCTTACCTTTCCTTGTATCCTGCGACTTGACACGCCATAATACACTCGAAttggcgctgcaattgcacCGAGTGACAGCAACA
CAATCTAAATAGTTCATAGGGGAATTAAACCACGACCAGGTTATCGGATCGTACCTTTGCCAGCAGTGCTGGAAgaatgctgctgtcgcgaaCTGAAGCT
GaggcagtcgcagcagcgtgtcgaaTTGCAGCACGTAGCGGTTACTGAATGCCAGACGAATTGGAGTGGGTGATACCTCCTCTGCAGGATTGCCACccat
gtcgtcgctgtcttgACAAGGTTCTTGGACAAGTACTGTTTGTACTAGAAAAGTAGCCTGAGTAAACTTGCATACGCGGAAGTGTTTTTGCGCCTTGATC
ACACCGAACGGTGGCAAGCTGGTAGTACCTCCACTGGTGCCAACACTCACAGTTTCACCGGCACGTAGCAGGCGCAGCTTTAAGTCCTTGGAGCCGTCCA
CGCATTGCATAACTCCCCCACCACCAAGTGGGCGAAGCTGAATTTCCAAGTCGTTCAGCGGCCAAGTAGTGAGGTTGCAACAACTGACATTGAGTGCAAC
CACATCTTCCTTCCCTGAGAGAGGGTGGTGATGGGAAATTCGGACGGAGACAGGATCAGCACTACCGGTGACAGTGATTGGCTCTCGGTACTCGTCATCT
TGCAATTGACCTGCTTCATCTTTGCCATCGAAGTGCTTTCTCGGGAGAAAAATGTCTTGTGGGTCAAAGATCTCTTTCGAGAACTGATCCTCTGGTCCCA
ACGGCGACCCGGGAGTCGAAAGGAGTTCCATGACGTCTTCAATGCTGGACATGAGCACAATACAGATAGGTTAGATACGATCAATACGACTGAAGACACG
GTTTTTCAACGTACACGCGATACTGCTGGGATGTCATCGCTGGCGAGCTCCCTGACGCTGATAAAGCTGCGATCATTTTTTCGCACATCAGAAGGAACTG
GGGCTGCGTATGGGGTTGGAGTTGCGCTAGTAGTGTAATACAATCACCGATCACCATCAGCGCGTCCACGCTGTTGGCATCACCCGCACGCTTACGACTC
GCAGGTGTCTCCTCTGCACTAGCAGCGCCGCATCCTAGCAAACCGTTGTCAAAAGTTGCGCCTTccatctcctcgtcatcatTCCAGATAGCAGTGAAAA
GCTGGCCGGTCTCATGTTGAAGCTCTCGTACAAGAGCTTCGAAGGGTACGTGTGCAGCGTAAttgcgatggagacgaacgCCAACCCAAAGAATTTGCAG
CCGGGCACTTTGGGACGCGATTTGGTCCATGGATGGGAACAACTCGTGCTGGAAAAATTCGAGCGACTCACGGAGCGCAAGCTCGGGGCAAGCAAGCATG
CCCTGAAAATGTGATGTCAGCAATCCCGTGTAGTAAACGATGTTCTCGCTCATCTCACAGGACCGACGATATACCTTCGGTGATGTAGTAGCTGACCCAC
CCAACTTTAATAACAGTAATCCTCGAAACACTCTTAAGGCAATAAGCTGCGATACTTGGTGTTCGACAGCTCCGCGCTGACGTGGAGACGTTAGCTCTGT
TGTGCTCGAAAGAGCATGAAAAAGTGCTCGGAACACCTCCGAGCCGTTTGTGCGTGGTGACAATCGAGAAAATCCCTTTGGTTGTCTGAAGAACGTCATA
GTACACAATCCCTGAAGTAGTTGAAAGTCTCGGTTGGTGATAATGTGTGCAGCGATCGTGTCCATGAGGGTTTGCACGAGATCGCGTCGATCTTTTTCGT
GGTCCAACAAGTAGAGCGCCTCGGCTGTACGCACGAAGAGCGACTGGCAGTTAACACCAGACAGCCAACTAAACGCCTTCACGAGCGTCACACAGAGCTC
GTACTTGAGCtcaccactgctgctaccgTTGCTCTTATTAGCCAGATAACACTGTGCGATGAGGTGGTTCGCGAGTTGAGCAGCCCAGCGCATACGAGTA
AAAGTCTGCAGCGGGTGTGCCAACACAATGAAGATGGCACGGCACATGCTAGTGGCCTGTCCTAACGACACCCGCCTCGACACCGTAGGAAATGCCCAGA
ATTCCAGTAGGTCACTCACAAGTTTGTCAACCCGAACAGGCTCTGTAGAGGCTTGAggttcatcgtcatcattgTCTGCGCTATCAGCATTATTTTCTTC
GGTATCAATCTCCACGTACGGCACACTCACGCTTGGGCATCGTGCGCCACTGCGCTCCATCATTgtgaacagcagcatcgaaatCCAGAGCATTGCATCT
GGTTGTTGCTTCATCGGCAGCATACGTGCAACAGCAATCAATGCTCGAATTCGCGGGAATGCTTGCTTGTACATCATGGAGGAAATGTCGTCGACGGGTG
CTTGAACGCAGATGGCTTCTCGAATGCTGGGAAAGAATGGTGCCATCGCACTAGATCTTGCAAACAAGTTCGCTAAGGCTGTGAAAGCGGTACCCGCAGC
CCATGCAGCACTTTGAGACTGCCCATCGAATGAAAGCGTGTGGAAAATCAATTTCCAGCAGTCGTTGACCATTGTCTCCACATCTTGTTGGCAACAAATT
CGTGCCTCGTGCGACTCGAACGGGAAGACGAATAATCCATCTCCAGTGACATTAATCGCCACATCTAGCGTTACTTTTGACACTGTCTCGATAGCACGGC
AGCGAACCTCAATGTCCTCGTGCATCAAAATTGATCGCAACTTGTTCATGGGCTCCCGTTCCGGAGATAATAAAAAAACCAGCACCAGAGGTACTGGTAC
GACTCCAAGCACTGGAGTCGCAGCAGCCAAAGTCGACGTACTCTCGGAACTGCCCAACTCCGTCACGACCGCTTCTAGAATGAATTTCCAGATTTCGTGA
GTGGAGCAGCCAGGAGCGATGGCAGCGAGTTGAAACCCGAGAATTTTCATTGCAGCGTTGCCTTCTGGTTTCAAGCATTCCTAAACGCGAGCAAAAGATA
TAAAGTTATTATTTTGTGGGTTTACTGAGAACCGTTTTTGGTGACGGTCCATACCTCCAGTCCGTCGCGATATTCACGCAGAGTTAATGCATTGGGTCTG
GCAGAAGAAAGTTGCAACAACTTCTGCACTAGAGTCAGTGCTCTTCTCGCACTGgcagcttcaccaccaccacctaaactctcctgcagcatcgtgaCGA
ATTCCTCCGGAAATGAGCGAAACGATCTTCTGCCAACGACGGTTGGCCTGAAATGGTTACACTAAACTTATGCAGGAGCAAAACATTTGTAAAGTACAAC
ACTTGTACATCGACATATCCAAGCAATGGACTTTTTGATCGTTTTAGCGCGCCAAGACGATCATGATCGTTCTACATCGAATTCTGAGTGGCAGTACTTC
AAGATTGCTGATAAAATGCAAGTTTGTCAGAGCCACGCTTCGACAAGACCGTTAGAACGGAGGATATTGGGACGGGTCATGAGGTTCTCTTCGTCTGCTT
TTTGGCAAGAAtcaaactgctgcaactcATTAAAGGAAATTCTACGGAGGTGCTACGGCATGGAAACGTAACATGAACCAGACAaagtcttcttcatcgc
agCTACGACCTTTGCTGGCGGATTCAAATCTTACGGATCAAGATCGCAGACAAGTTCGAGTTAGAGAACATGAACTGTTGCAGAATATCAAGGAGAACGC
TGCAGACTTGGCTCAACTAGACTCGAACAAGTTTACTCATGCCACCAACGACTTGGATGCAATGTACGAGCACGTGTGTTATCCTCGCGAAGCTGGTTTG
GACGGACTGTGTCTATACGAGCTGGGAGCTGCAGTGGGAGGGCAAAAGGACATGTTGAGTGGCACGGATATTACGAAGGTTTGAAGCTCTCTTTGCTGGA
ATGATGGGTCGATGTGCTTAACTTTGTTTTTATGCAGTTTTCACGAAGACTTGGGTGGGTAATTACGTTTTAACGCGCGGATGGATAAAACGGATGGGTA
ATACATGTTGGCACAAAAACCCGAATGACTGGCTCACAGGGAACTACATGTAGAACACATCCATAGGCAATGGACCATTGTGGCGTGTTGCTTGGTCGTG
AAACAAGGCAGAATGCCATTCACTTCTGCTTTTGACCAGAAATAGCCAAGTGCAATTCCCCCGATCACCAGCTCGCT