Description :
From Genome Similarity Track
Location :
Scaffold_2375:1384- 3343
Sequence
1959 bases(100 bases per row)
CTGCATCGCGCCGAACCGATTCTGATTAGCGCGATCCCACAGGAACTCGTGTAAGCGTGCCCCAAAGTTGAGATCAGCCTCGTCAACCCAACTGGGCTCT
GTATACACCTTCCAATGCACTAGGAATTCCCGGTAGGTCCTACCATATCGCATTCTCCAATCCTTCCCCATATCGGTGACACTTTCCACTTGGTACTCTT
TCCCATTCAAATCTGAGGCCCAACTGTCCTCTGGCAGGAGGATCTCGTCAAAGTCCAGCCGATCAGCCTCCGGTACGGTTAGCTCGGCCTGCGGTTAATC
TGGGAACTCCCGGACCGGCTTCAGGTTGGACACATGCACGATCAGGAAGAGGCGGTACTCCGTTCTGGAGATCTAGAGTCGCATGGAAAACGGGTTCTCT
GCGACGCGGAAAGGTCCGTGCCACAGATGTGCCAGCTTACGTGCGTATCCCTCTTTCACCCGATCCAAGTACAGCCAGACTTGTAATCCGGCCTCGATCC
GATGCGGATCGACGTCAGCATTGTGCAGATCGGCCCGATCTGCGAtcgccttgcgcagcttATCGTTGACCTTCGCCTGGATGTAATAGCGCTGGATCTG
GTATCTCCACCTCCTAGGATTCCGATCTCGCGTCCGCATACTACCCAGTGGCACAGTTGCTTCCCACTTCGATCTCGGATCACAGCCATGTACCAAGTAG
AAAGGCGTATCTCGCGGATCCGATCCTGAGCCGTGTTGATAGCGAACGTCAGTCTCTCGGCATACTCGTCCCAATCTCGCTGATCCAGATCATGTACATA
CATATTCAatgcgcgcgtcgtcgtcggcaccATTCATTCGGCCGTTCTGTTCGCTTGTGGCCGATAAGTCATCGTCACCCGCTGACGTTGACCGAGGATC
TTATAAATGGCACGGAAACAGTTGGACATGAGCCCTGGCTCCCGGTCGTGTCGGATCGCCTCGCTAGCTCCAAATCTCTGGAAGACGCATTCTTCGTACG
ATTCGGCGATCGTCTGAGCTGTTCGGAACGCGCTCGCCTTCGCGATCAAGTTCCCGGTAAAGAGATCTTCCCAGATCAACAACTCGGTGTTGCCTTTATA
CGACTTTGGGAGAGATGGTATGTGATCCATCGCAATGATCTGGAAAGGATACGTCGCCTGGAAGTTCCCGGGCGATTCACCTCTGGTCGGCCCTTGCCCG
TCTCGCAATCCACACACTCACCAACATATCTCTGCACGCTTCGAAACAGGCCCTTCCAATGGAACTGTTCTCGAATTCGCTGATAAGTGCGGCCGATCCT
TTGGTGACCACCTTCGTTTCTTGTGTGATAATGATGCAAGATATATTGGTGGAGCATCTCTGGAGCAACTAGCCTCACCAACCCGTCCCGACCGACATCC
GATCGTTTGTTAGGGGGACAGTAGAACAAGAGATCGTGGTCATCCACTTCGTAATCTGCGGCCATTTTCCCGTCTGATCTAGCTTGGTCTTGGGTGAGAT
CCGTCACATCACCAGCGAGGTACTTCTTCATGCCTGAGATCCAGTCTTATTCGTTCTGCGCCTGTCGGATACGCTCGATCCGGAGGTCTCGGACCAactc
ctcgttcagcacAGGCGGGTCAGATTGGGGTCGAGCGGTCGATCGGGTAGTCACCGGGGATACTCGTACCACTGAATCATCCGACTGGGTGACTAGGACC
TCGGCTATCCGATTCAGGGTGACCAGATCCTGATGCTCTTTCTcgctctccaccaccacgcctAGGTGTCGCTGGAGGGCCGCACCGGCTAGACTGTCCG
CACTACCATTCCAATCCCGTTTGAAATGCAATATCTCGTGATCGGGCCAGACACGCAGTCGATCGAGAACTTTATGTCTCAACAGGGTCAAGTCAGGTGC
CTTGCTATCGACTTGACATCGGGCTTGCCGGACTACTAGATTCGAGTGATCGATCAGAT