Description :
From Genome Similarity Track
Location :
Scaffold_192:1384- 3262
Sequence
1878 bases(100 bases per row)
CTGTGCTCTCGTCTCCGCGCACCACTGTCGCTGCTGTCCGTGGTCCAGCACTGCCGTCCTCGCGGGCTCGTTAGTTACGGGTGGTATCGCTGCCATCCGT
CCGGGTCGGCACGGTCAAGGCGACGCTGGCACCAACCTGCTCCGACCGGACTGGCGGCGGCGAGAGCCCCGACTTGGACTGGCGTGCTGGCGCCACGCAT
GGACACCGAGGCGTGTGACGGCAGCAACGACGCTTTACCACAGTAGCACGGCGTGGACAGGCAAAAAGACAAAAGCAATCGCCCACCGTGGGGCTCGAAC
CCACGACCACAAGATTAAGAGTCTTGCGCTCTACCGACTGAGCTAGACGGGCTTATACACGACCCACACACCACAAACATACAACATACAACGCCACGCC
ACACACCAACAAACACACGCGCACGCGCACACACGCATCACCGACAAGGCCTGTGCGCACGTGCAGCCAACAGCCGCACCAATACGCGTCTTGCTGCCCT
CACCACGTCTCCATTGGGCCTCGCCGACCGTCCGCCTCCATGACGGCGGGCTGTGCTCTCGTCTCCGCGCACCACTGTCGCTGCTGTCCGTGGTTCAGCA
CTGTCGTCCTCGCGTGCTCGTTAGTTACGGGTGGCATCGCTGCTACCCGTCCGGGTCGGCACGGCCAAGGCGACGGTGGCACCAAGCTTCTCCGACCGGA
CTGGCGGCGGCGATAGCCCGACTTGGACTGGCGTGCTGGCGCCACGCATGGACACCGAGGCGTGTGACGGCAGCAACGACGCTTTACCACAGCAGCACGG
CGTGGACAGGCAAAAAGACAAAAGCAATCGCCCACCGTGGGGCTCGAACCCACGACCACAAGATTAAGAGTCTTGCGCTCTACCGACTGAGCTAGACGGG
CTTATACACGACCCACACACCACAAACATACAACATACAACGCCACGCCACACACCAACAAACACACGCGCACGCACCCACACACGCATCACCGACGAGG
CCTGCGCGCACGTGCAGCCAACAGCCGCACCAATACCCGTCTTGCTGTCCTCACCACGTCTCCATTGGGCCTCGCCGACTTACGATGGCCCCGTCCGCCT
CCATGACGGCGGACTGTGCTCTCGTCTCCGCGCATCATGTCGCTGCTGTCCGTGGTCCAGCACTGCCGTCCTCGCGGGCTCGTTAGTTACGGGTGGTATC
GCTGCCATCCGTCCGGGTCGGCACGGTCAAGGCGACGCTGGCACCAACCTGCTCCGACCGGACTGGCGGCGGCGAGAGCCCCGACTTGGACAGGCGTGCT
GGCGCCACGCATGGACACCGAGGCGTGTGACGGCAGCAACGACGCTTTACCACAGTAGCACGGCGTGGCCAGGCAAAAAGACAAAAGCAATCGCCCACCG
TGGGGCTCGAACCCACGACCACAAGATTAAGAGTCTTGCGCTCTACCGACTGAGCTAGACGGGCTTATACACGACCCACACACCACAAACATACAACATA
CAACGCCACGCCACACACCAACAAACACACGCGCACGCACCCACACACGCATCACCGACGAGGCCTGCGCGCACGTGCAGCCAACAGCCGCACCAATACC
CGTCTTGCTGCCCTCACCACGTCTCCATTGGGCCTCGCCGACTTACGATGGCCCCGTCCGCCTCCATGACGGCGGGCTGTGCTCTCGTCTCCGCGCATCA
TGTCGCTGCTGTCCGTGGTCCAGCACTGCCGTCCTCGCGGGCTCGTTGGTTACGGGTGGCATTGCTGCCATCCGTCCGGGTCGGCACGGCCAAGGCGACG
CTGGCACCAACCTGCTCCGACCGGACTGGCGGCGGCGAGAGCCCCGACTTGGACTGGCGTGCTGGCGCCACGCATGGA