Description :
From Genome Similarity Track
Location :
Scaffold_2186:1384- 3141
Sequence
1757 bases(100 bases per row)
GTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACATCTAAGTTGGATGATGGTT
CCCAAGTTGGATCTTCATAGCCCACCCACTTGACTTTGTGCTCGCGTACAGCACGCTCCGTGCTCGTCGTCAGTGGTGTTCTGTCGTCGAGGATGCCCTC
GACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCCTCAGGCAACAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAGTACC
AACCGAGTGTTCGGTCGACTGTTGAACTTGTTGACAGCCTTGAGTCTCGACACATGCACTACTGAGTAGAAGCGATACCCACTTCGGTCAGGCAGTTCCA
GCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGTA
CAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCCATCTCTGTCGAAGCTTCTGGAGGGTCCGCCGAGTGTTCG
TTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCAGTCGACTCAGGGCCTCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAATCTTTGG
CCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCGCGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGC
CCTCAACGTCGACTGAGCATCCCAACCGTGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGGCTTGAGAAGTATTAATCGCAAATACTAGCTTCTCC
GCGATTTCGTCCCAATCTTGCTGTATAGGGTCTTCCGCGTACACCCGTACGGAACCCATCACTGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTG
GTCGATAGCTCAAAGTCGCTCGTGATCTTGACTGCATCATCTCTGCAAATGCTTGGAAAACCTCGCTAATGAAGCGTGGGTCGCGGTCGTGCCTTATTAA
TGATGGGGCTCCGAATCGTCGGTACACACATTCTTCGAGCACTTGGGCAGCACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGTA
AACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGAGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTA
GTACGTTGCCAGGTGAGTATCCACGAAACTGTGGACGGCTTTTACTCGAGCTGCAATCTGGACAGGACTTCACGTGCTTCTCCACGTCTGCGTACAAGCC
GATCCAATAATAATCGGACTTAACGCGGTGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGCGTCGTGACAGTTTTGCAGGACCTCTTGAATC
ATCGTTGTTGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCTTCTGATA
ACACGAACCGGTCAGCATACTTCCAGGCATCTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATGTTAAACCACTTCTG
TTCCTCGTCTTGTGCCACTAGTATCCGTCTGCGTCGCTCCCGCTGTATCGCTACCGG