Description :
From Genome Similarity Track
Location :
scaffold_1181:1384- 2629
Sequence
1245 bases(100 bases per row)
AAATACTGATGAACTAAGTATACCTTCTATCACGCCATCACAGGAGCCATCATAGGAAACAGCTCCTGTTTGCTCTGCACTCAACGGCCGTTGTGATTAC
GCGTGTGTTTTGATCGTAGGACACAAGTAAACATGTACTTGAGGACTGGTATTATAGGATTGTATAAAGCTTAGCGAAGGTGATGCGAGTAAACTCCATC
AAAGTTGACTTCGTCTCGTCTTTACTATTGACGAACGAGTTGATAACACCTAGAAATGCAGTGTTGTAATTGGTCGAAAATGAATATTCGACAGCGACAA
ATATGGTAAAGAGCATATATAAGAGCAAATTTGCGCCACATCCAACGATGTATTTAGTACGAACCAAGATCCCTCGAGGCAACAAGTGATTGGCAATCAC
GAACGTCCACAACGACTCATTCTCAAACCTAAGCTAACCCCACTAATGGATGCTTCCGCCCCCAATTCCGTCACATATGCTGCTTGTAGATGCCACAATG
TAGTAATTGACCACGTAAAAGAGAAGGTGGGCATATTCAGCACACGCGACAGCTCGGACGCCTGCTTGAGACGCTTGAGAATGGAGTAAGTCTCGCCATC
TTCATCTTCTGAAGACTTGGTGTCGAAAATCAGCGCACACGTGACCACCATCTTCAGGTACTGCGTCGTGCCTAAATCCTCGGAACCGAGCGAGTCAACA
GTGACTTGTCGGTCACATAGGTCGCCCACTGTACTTCAATTTTGTGCGACTAGCTCTGCTAAGATAATGGCAATGATAATCGAGATGCCTTCAACACGGC
ACAATTGCTGTATGTGCGAGGCCTGCGACTCCGTGCGTGAAGGCAAGTAGAAGTTCATAATCTTGCACTCGTTGAGTGTATTGTCGAGTAACAATTTTCT
GGGTGCCAATGGCGTTTAACTCGAAACTACAGCAAGTTTACAAGCTCATCCCAACATGGCGATACATATCGGGACTAAATAGCATGACTTCAAAATCCTC
CAGTACGAGTTCCAATTGCTGCGGCCGAATGCCTTGCAATTTTTTCCTACACTTACACAAGATATACTGGCTGTGGTAGTTATTAAGCTCTTCATCAGCG
TCATCCTGCTTGCCCAGTTCCTCGTGGTTGGTCGCCCAACACCGGGTTGTACCTCTCGATCGACATATCGCAGACTTCCTTCATCGTGAACCTTCTCAAT
GCCAATTTGGGCAACACTGCCACAAATAAAATACCATTATTTAAT