Description :
From Genome Similarity Track
Location :
Scaffold_1098:1384- 2387
Sequence
1003 bases(100 bases per row)
CTGGATGCGCCGCTACATGCCAGGCAGCCTTGTACACGTCATCTGGTCCTTGTAGTCATCGTTCTGCAAGATTGCATCTCGTGGCACACAAAGCTTGTGC
AATGTTCTGTAGGCCAAGGCCGCCAGCTTGAATTGGTGTGAATATTAGAGCTGGATTCAGTTTATGCCTGGATGATTCTACTCCAGTTTCCCCCGTCCAA
ACAAAGTTCTTCTGTATGTTTTCGAGTTTCTGCATGACCTTCTTCGGCGTAACAAATTGTTTCCCTGTGTACAAGATGACCAGTAAGGTCACAGCATTAA
AGAGCTGGACTCTCTGGACGACAGAGTTACTGATTGCGGAAGCGATACGGAGTCTCCGTTGTATTTTTTTGATTCTTATGTTCCAGTTTTCCAGTGTGAA
GTCCTCATTGCCTACCCAGTACCCAAATTGGTGCGAAGTGTCATTTCGACGTAGTACAGGGAACTCATTCCACTTCGTTGAGGTTCCTGCGGTGTTGAAT
CCAATAGGTAGACTCTTTTGGGGTTGAACCCTTAGGCCGGAGATCTCTCCAAATTTATCGGGAATCGTCGTGACAGTGTCCAACTCGTGGGCGGATGCCA
TGAACACTATGCTGTCGTCAACGAAACCTAAAAAATTATGCCGCTTATTGTCGCTACCTGGTACGGGAATGCCTTGTAATTTCGGATTGCGGGGAATGGT
TTGGGAAGATTCAATTTTCATTAACTTTAGCGGGGAATAGTTTGGGCCAGCGTATCTACTGCAAAGTTGAAGATAAGGGGTACTAGAGGGTAGCCTTGGT
GAATGCCTGATCTTACCTCCCAGTCTTGCGACGCTTGCCCGTTCACTAAGAATCTAGCTGTTGTGCCATCATGCAGCAATCGGATCACGTTAATAAACTT
GCGTGATAATCCATATTCACGTAGCACGATTTGAACGAAATGGTGATCCAGTGTGTCATAGGCTTTGCGAAGGTCTAGACACATTACTACGGGCCCATCT
GCC