Description :
From Genome Similarity Track
Location :
Scaffold_17:138387- 141592
Transcript NameFunction/comments
Albla_Nc14021720myosinlike protein putative

Sequence
3205 bases(100 bases per row)
ATAAAGCGCTCAACAGGACAGAGCAATTTTGTCCGAAATCGGCAAACGTATCGCAATCTGCTTCAAAGACCGCACTTTGACCTTGAATCAAAACGCAGTC
AGTTCATGATAGAACAACTACAATTCAAAGAAGCAAAAGTGAATGATAAATCAACCGCACCGAGTGATACAAACTTCATAGTTCCTGGTATGCAGTGCTA
TGTTCCAGACGATGAACATGTGTGGCTTCCTGCTCAAATTGTCAGATGCGATGAAAAATCAGGCGACGTAGAGGTTGTCGTTTCCTTCGAGGACGGAATC
GCTGAGACCCGTCTTGTAGACTTGCACAATCCGAAAATTATAAAAGCGATTGGCGGTCCTAAAGCCACCAAAGTCGAATCCTTACCACTTGCTTGGACAG
GCGACACGATCGAAGGTGTCGAAGATATGCAGTCTCTACGCTTTCTGAATGAGGCTTCCATTCTATACAATCTGAAGAAGCGATTCCTCGCATCACTTCC
ATATACTTTCACCAACACAATCGTGATTGCATTGAATCCATACAAATGGATGGATTCATTGTACGGAGATGAGCCATCAAAGCTTTACATGAAGTGCCAT
GGTCTGAAGAAGTTACAGCCACATGTTTACGCGACTTCGGCGGCAGCGTACCAACATTTGCTACAAACTGGAAGCAATCAAAGCATTCTTGTAAGCGGGG
AATCTGGGGCGGGTAAAACGGAGACTACAAAAATCATCATGCAACACCTGACAAGCATCGCAGGTGGTTTAGATGACTCTACCGTTGACAAAGTAATAAG
AGTCAATCCGCTTTTGGAATCATTCGGAAATGCCAAGACGTCTCGAAATGATAATAGCTCACGTTTTGGTAAATTCACACAATTGCAATTCGATGCTAGC
GGAATTCTTGTTGGCGCCAAGTGTGAAGCATATTTGTTGGAGAAGTCTCGAGTAGTTTCGTTGGTTCAAGGAGAGCGCAACTACCACATATTCCATCAGC
TTTTGGCAGGCGCATCCGCAGAAGAACGTCAACAGCTTCAGCTCGACACAAACAAGTCTTTTCGATATCTGGGTGATTCATCTGAGCAAACAGTGATCGA
CGGCTTTGATGATGCGAAACTTTTCACCGCGACCTGCCGGTCGTTATCTTTGATTGGCTTGAACAATGACCAGCAATTGTAAGCTTCTTTATCTGTTTTT
CGACAAGCTGGAACACATTGTCACCTCATTTTGTTTATATTTGTAGTACTTTATTCAAAATTCTTTCTGGACTATTGCATCTTGGGGAGGTCCAATTTAT
GGAAACTGATGAAGAGGGATCAGCCAGTCAGAATGTGGAGCAACTTTGTGTGGTATCGGAGCTGCTTGGACTAGCTTCAACAAAAGTCGAAGGAGCTCTA
TGCACTCGGTCTGTCGTTGCAAGGAACGAAAGTGTTACCGTCTCACTTTCAGTAGCGGATGCTGAAGAGAATCGAGACAGTTTGGCTAAAGCCATCTACT
CTAAGATATTTGATTGGATGGTCAGAAGAATCAACCAAGCGATTGCAGTTGATGATGATGTCTGCAGTGGTCAAATTGGTGTGCTCGACATCTTTGGGTT
TGAAGAGTTTGCTCACAATGGTTTCGAGCAATTTTGCATCAATTACGCAAATGAGAAATTGCAGCAAAAATTTACTTTCGATGTATTCAAGACGGTCGAG
GAAGAGTATACTCGAGAAGGCTTGCAGTGGGATCATATTGAATATCCGGACAATCGTGAAATCATTGAGCTAATCGATGGAAAAATGGGGATTTTAGCCT
TGATGAACGACCATTTGCGCCAACCAAGGGGTAGCGAGGAAGCTTTAGTGAACAAAATACGTGCAAGCGCTGAATCTCAACTCGATTCTACTTGCATTCA
ATTCCCCAAAGTGAATCGCACTCAATTTACGATCAATCACTTTGCTGGCCCGGTCACCTACGAAACGGTTGGGTTCATGGAGAAACATCGGGATACACTG
CAAAATGATTTGATGGATTTGGTCTTGACAAGTGAGCTCGACCTATTGACAGAATTCTTTGGTAGTTCGGAGGCACCTCGCGAAACAAAGATGTCAAAAA
GTAGAAAATCAACCAGCAGTAAGAAAAGTCTCGGCACACAATTCAAATCATCGCTTTCGCAGCTGATGGATAACATCAAAACTACCAACACGCACTATGT
TCGATGCATAAAACCGAATGCCAACAAAAGCTCTACTGAATTCGACAATCAGATGGTCATTGAGCAATTACGCTCTGCCGGTGTGATCGAGGCTATCCGA
ATCACTCGATCAGGATATCCTAGCCGGCTTACACCGCACGAGCTAGCTACTAAATATTACATCATGTTTCCTCCGTCAATGCAGAGAAGGGATGTTTTTC
AGACATGCTCAGCCTTTATGACCGCAATTGGTCGCCGCTCACCTCTCGAATATCAAATCGGAAAGAGTCTTATCTATTTTAAAGGCGGTGTTTTAGAAGA
GCTGGAAGCCATGAAGTCCGATTTTTACTATAACGAAGCCACCTGTATTCAAAAAGTTGTACTGGGTTACATTCAGCGCCAGCGTTTTCGTCGTATGATA
GAGGCCATCACTGCATTACAAGCGTGGTCACGTATGGTCTTGGAACGGGCCGAGTATCAATATGCGCGAAATGCAGTCATAACCATCCAACGAGTCTGGA
AGCGATATTTGAATAAAGACCTCATAGATTCGGAAGCCCGTGGACATTCTTATGACAATATGCAAGAAAATGATTTCGTGCGTATGTCCGATGGTGAGTG
GGTTGATGATGAAGATGCAGATGATCGCCTCACTGAAGGAAGTGAGTCGAGTTTTGAATGTAGCGAACCAGTCGCATCTGCATACAAGAGTCTTAAAGCC
ACGCAACCGTCACATACGCAACTACCATCGAAGCAATTGAGCTACGAATCGACCAAGCGTGATTCAACATCTTATAATCCTTCAGTGCACCGAACATTGA
ACATGGATGAAATTTCAGAAAGTGCAAAACGTATTTTGGATGCAGTCGAACGTAAAGAAAATTTGGAGCCCATCAGCTTGCAAGAAGAAAATACAATATT
GCGCTGGGAAAATCGAAATTTGAAGTACGACCTCGAGATGATGCGAGAGCAGTGCAAAGACCTGCAGTCTATAATTGTCGAGATCAACCGGAGCCGAAAG
CGATA