Description :
From Genome Similarity Track
Location :
Scaffold_315:13836- 22470
Sequence
8634 bases(100 bases per row)
TCTCAACTCTCAAGATCCCGTCACCGGAGGCGGCAAGTACGACTTAAAGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCTAGAT
CCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCA
TCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGG
AAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGA
TCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGG
AAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGA
GGTGGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACA
AAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACGAGAA
AGAAGACGAAAACGAGTAAGACTACGCGGAAAAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCT
CGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGCTCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCG
GTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAG
AGGATATCTTCGGGCTAGATCTGGATCTCATAGCATCCGCGACGCAGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGA
TCCAGTGTCATCGCCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACT
TTAGGACCCTCCGGGGCATCCAGGCTGGAAGCGCGGGCGATGGTCCGAAGACAGGAAGCCCCTGTGAACGTGAAGGCTCGGGATCCAGTACGCCCTACGC
GTGATCTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGGTTGTCTTCAGATCGGACTCAAGGTAATCGCCTCACGGATCCTGT
CTCGCCAGTGGACCAGCCGGCCACGGGCTCTTCCGACACCTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAG
GGTATGAGAACGCCCGTGCCACAAGCGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCAGTGGAGGGAGACAACTCCCATGATGAGC
TCGACCCAGATGATCTGGATGGCCCATCCCCGTCGTCAGCGGTGGTAGCAACAGCCGCAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGAT
CTCAGCCATATCGGATCTGAAGGAATTCACGGGCAAGGATCAAGATGAGGACCGGGCGAGAACATGGACCAGCAAGGTCAAGTCGGCCCTCATGAGAGAT
CAAGCGTCGGATGCCGAGAAGTGTCTGACCTTTGCGGATCTGCTAGCGGGGTCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGT
GGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTTGCACGACAATACTACCATGCCCGCCGCCGATCGGACGAGTCCCC
GCTAGAATACCTTCATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTACGGGAACATGTGGATCATTTC
ATCGAGACGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGTTACGTCTTCCAGACGCAGATGAGCTCGAAGAAGTGCTGCGGGCTGTGGATCGCG
CGAAACACCGCCAGAAGAAGGCACCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCTCCAGCTCGACGTGTCCACCAAGTCACGGC
GCCCGACTCAGGAACTGAATCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGTACGAGCCGAGCGTTC
TAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTATATCCAGGTAGCAGGACCCTAGATCAAGTCGATAATACACGTGATCTACATGAAGTGCCA
GTTGCCAAGATCTCTAGTTTGCGCCAAGTGGATGAGTTTGCCAGATCCGAAGTCTCTTCAACCCTGGATCTATAAAGGGGAGAGGCACGTGGTTATTGGG
AGAAACGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTGTGGATCTGAGGA
TGTTGGATCCATGGATCTGCTAACAAAGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATC
AACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTC
GGATCCAAGATTGTGTTGGGATTAGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGA
CATTTGGGTCGGGGATCTCGCTGGTCAAGACGCCATCCTTGGTATGGATTTCATGGTGCCGGCCGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGT
TTCGCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATAAAGGCGGATAAGACCACCTGGATCGAGCCCG
GGGAAACTTGGGAGCTGCCAGACCGGTTAAAGTGGGCGGAACATGAAAGACTGTGGGTCACCCGGGGCGAGAAATGGGTACCTACCGTAATCCAAGGACC
AGGTCGATCGCAATACCTCCAGGTCACGAACGTCAGCGACAAGAGATTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTGGCGAAGGACGGTATC
CCTAGACGACCTGGATATGTGTCAGTGGGATCCCGCCCCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACCGAGATCGAATCTCTCGCAGAGGTGG
AGCTCCCAGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAAT
GGAAGTTGGATCCAGGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAGCAGCCG
GATCCCGCTGATCCACAAGTGGATCCAAGCTCTCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCCGAACTGTCGGGCT
TAAACTCGTTAGAGGACCAACTGGATCCAACTGGTGGTTTCCCTGATACCAGGGTACCTGAACCCCCGAAGATAGAAGGACTGCCAGGCGAGAGAGGGCC
GCGGTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGTTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGC
ATGGCGGTGATCCCGGAGGTACCACTGACCACAGAAGAAGTCACGATTGATGATATCCAAGTGGATCCGGGGGCGAATGAACCTGCTGAAGTGGATCGTC
TGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGA
CGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGGCACCTCAATTCCGGGAAAAACTATCGGACCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGT
TTCTCGACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGA
CTCGATTGATGGTGTATCCGATGCCCCTAATCAACGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTG
GGTGGTTAATATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGAACCGGATGCCGTTCGGATTGAAGAACGCA
CCCCAGATCTACCAACGCCTGAACGATAACGCCCTCAATGGATTCACCCGAATACCGGAGTTCGAAACAGGTGGGTCCGGGGAAGGCCGTACGGAAGTGG
ATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGGGACCCCATCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGA
TCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGAAT
TACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCGTTAGCCGATTTGTCCTTCCCGCAGTCGTTACGGGCGATGC
AATCCTTCTTGGGCAGTTTGAACTACTACAGTCAGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTACGAATTGAGAGAGGTAGATTTTGCCGC
GATGACCACTCCAGCTGTCCAGATGAAAATCCAACAAGCTCTGGCCCAGGAGATGCCGGATCCACGAAGGGATCCAAGTGGTAGGACGCCAGAAGAGGAC
CTGAAACAGGAGCTGGATCCACCCCGGGACCAACGGAGAGAGGATCCAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGA
TCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGACCCGGAACGCCAACCTGCGGTGATAGTTTA
TGCCAGTGATTGGGCAGTCTCTGCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTG
AACTACGGAGCGGTGGAGAAAGAGGTACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGACCCATCCCGGATCCTGACTCGA
CACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAGT
GTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACACCTCGAGCTAAGATGGATGAGGCGCTGACTAGGATCGCTCCTAAGAAAGA
CCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGTGGATGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGA
GGAGCATACAGCGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATA
ACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATCCAAAACGGCTGGTGATTTGTGGGGAATCCAAATTTGGTAAACAGACAGGTGCGAGGTG
AGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGCGGTTGGTTGAATCACGAGTTGGTGCATGTCAAGCGAGA
TTGGAATGTCAGTGCGGATAGCTTGGCCAGTGCCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGCTG
AATCGACTAGACGAAGTGGTGGTAGTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCGGAGGAAGGATTGGATCCAGCCCCCAGA
TCCTCGAGGAAACGTTTGTGAGGAGAGTCCGCATTGAGCCGACATTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGG
GGATATACGAGACTTGAGCCTGGAGGATGCCAAATCCTACAGCATTATCGCTACGGATTAAGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCT
ACGAAGAGAGTCCACGAAGATCGGGATGGATTGATGAGATTGGTGATGCCAGAAACCTTACAACAGGATGTCCTACACCACTACCACGCTAGTTTAGAAG
GTGGACATCAGGGGATTAGTCGGACCTACCAACGAATCCGGGAACCTTTTCTCTGGAGGGGACTATTCAAGAGCGTGCAACGATATGTCGGTGAATGTGT
GGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATC
CCCTCGTTACCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGATCTGTTTACCGGATACGTGATAGCCAAAGCCAGTGCGTCTAGAACTG
CGCAAACTATTGCCGAATCGTACGAGGACTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTAATTT
CTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGATCGGCCGAGCGCATGGTGCAGACAATC
ACGAGAGCACTCAAGATGTATGTCCAGGATTTGGATCAGAAGGATTGGGATGAGTCCGCAGAGCGGCTTCCCTTCGCGATGAACACCGCCCAAGACAGGA
TCCGGGGTGATACACCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTGGAAGCGGCCATCCCAGTTTGCAGCACCAAGAAGAGGAACCGAGA
TCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGGTCGAGCGGATCGA
CACAACGAAGATGCCCGTCCACATCAAATCCAAGTGAGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAGGGGTATGCCCGCAAATTAGCCCACC
TATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACACGCGGTAAAGCTGGAAACGGTAGGTACCGAATACCGCCTGTTCCCTGTGGTACACGT
ATCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCAGTGGATGTATCCGACCGCGTGGATTTCGACGAAGTCCTCCTACCG
GAAGATAGTTGGAATGTGGATCTCGAAGACGACGAGTTCGAAGTCGAGAGGATCACCGATATGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACC
GTGAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGAGGGATCG
TACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAGGGGACCCATGGATGTGAGTTGGTCATGTCGATGGGAGGATGAAGAAG
GGCCCACAGGAAGGGTGTGGGCCGGGAGGAGGGG