Description :
From Genome Similarity Track
Location :
Scaffold_357:13836- 16290
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_357-fgenesh-gene-0.1U3 small nucleolar RNA-associated protein
Pytve_DAOMBR484maker-pve_contig_357-snap-gene-0.10Gene of unknown function

Sequence
2454 bases(100 bases per row)
TCCTGCACAAGGCGACCGCCAAGTCGCTCGTGATCATTGACGAGCTGGGCCGCGGTACGTCCACGTACGACGGGTTCGGGCTCGCGTGGGCCATCTCGGA
GCACCTGCTCACGAAGGTGCGCGCCATGTGCATGTTCGCGACGCACTTCCACGAGCTGACGGCGCTGGCGCGCGAGCACCCGGCCGGCGGCTTCGTCAAC
AAGCACGTGACGGCGCTGACGAGCGACCGAGACATCACGATGGTGTACCAGGTGCGGGACGGAGCCTGCATGGAGAGCTTCGGCGTGCACGTGGCGCAAA
TGGCGGGCTTCCCGGCCCAGGTGCTCGAGACGGCGCGCCGCAAGAGCGACGAGCTCGAGCTGATGGAGCGCGCGATTGGCGAGGTGCACGATGCGAGTCG
CAGTGCGAAGAAGCGGACGTCGTCGGCGGATCCGCCGGCGGACGAGGGCGGATCCGCTCCGAAACGCGCGAGGACCACGTTTCTGCACGCTTTTGCGGCG
CTGCCATTGGACGAAATGCCGGCGGACGAAGCGGTGGCCGCCGTCCGCTCGCTGCTCTCGGCCAATCGACTGGAAGCGGCCAGCACTTAATTGCCATAGT
GAATGCAAGTATATTTTGCCTGTCTGAGGTTTCCTTTCGCGTTGCCGATTGCCTGCCACCAAACTCTGTCGCCGGCGGCGCTCGCTCTCGTTGAGCGCGC
TGTATCCGGGACACTGCACGTCGACTGGCGGCCCGCCGACTGCCGTGACATATACGCTCGTGAAGAGCGCTCTCTGCTGATCACGCCCGTACCGTTCTGA
TCCCGAACCGAGCAACAGAACCCGAGAAAATGGCGGACGAAGGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCCACCGCTTCCAGAGA
GTGCGGGAGCGCGTGCAGAACCTGCAGAGCGAGCTGCAGCTGCACGCCAAGAGCAATGCCGTGCACGGCGAACTGAGCTTCGTGGAGGAGCTGCAGCTAC
AGGGCGAGCTCACGACGCTCGAGAGCTTCCAGCTCCTGCACCGCCAGCTGCAGCCGCTCGTGACGACGACGCCGCAGCTGCTGCACCACCTCGCCAAGGT
CGTGCGCGTGCTGCAGGACGAGCTCACGTCCGCCAAGGAGGACACACAGGTGCAGCGCGAGCGGATCGTGCCGGTGCTCAAGCTGATCACGGCGCTCGCG
CGCGAGCTGCGCAAGGAGTTCTACCCGCACTTTGCCGCCACGCTGCCTCTTATCGTGGCCGTCATCGACACGAAAGATGTACGTTCTGGTCTGAAATTGG
TCGGTGGTGGAGGAATCAGAGAAGCTAACTGTTGGATCGTGATGGCTTTGGGAATGTGCAGCCTGAGCTGAGCACACAAGTGTTCAAGACGCTCACGATG
CTCTTCAACTACCTGCGCGCGCAGCTGCTCAAGGACATGGACGCCGTGCACAAGTGCTACTTCCCGCTGCTGGGCCACCCGCGCGATTTCGTGCGCGAGT
TCGCGGCCCAGACGCTTGCAGTGCTGCTGCGTCGCATCGACAACGTCAAAGACATGAAGAAGTACTTGGCCGCGTATCTCCGCGCACTCACTCGCGGCGC
TGGTAAGGACGACGAGATCCTGCAAGACGGCTCGGCCAAGCTGTTCTTCGCGCTGGTCCGCAATGTCAACCACGGGTTCCACTCGCGCATGCGCGATGTT
GTGCTCTTCCTGCTCGGATCGTTTCGGCCCAAGGAGGTGAAGCAAGGGAGCTCAACAGACGATGGCGAAGAAGAACAAGCCCAGATTGAGGCGCAGCGAG
CGGTTGTGTTCACCATCGTCAGCAAGACATGCGCGCTGATGAACCGGCACACGGATGGCGACCATTCGAGCGAGCTGCTCGACTGCTTCACGCTGGCTGT
TACCAAGGCTGCCTCTGTTCGGAAAACGGAAGCTGACTCGCAGTATGTGGCTCGACTGATCAACGTGCTGACGATCTGCGTGCGCTTCCGTGCCGGAAAG
CTCGTGCACGGAGATGCGAAGCGACTTGCTGCAGTCCACAAAGTGTGCGTGTCAGTGCTATCGGACTCGACGATTCTCTCGTCGACATGTCACGAGCTGC
GCGACAATCTCCTGCTGCTGTTTGAAGCGGTCTGGCGGTTGTTCCCCACATCTCCGACTGATATGAGTGCTCAAGTGCGGGCGTTCTTTGACGCAGCGAG
ACATGACGACGGCGACAGCGAAGTGGCGGAATACTGGCGATCCAGTCTCTTGGAGTACATCAAGCGCACGCTTCAGCACGCTTACGTTACGGTGGATTTT
GTGAAGCAGTTCATCTTCCCGAACGCTGTTGAGTTGGCGTTTACCAGCCTCCTGCGAGTTGACATCGACGCATTCAGCCGGTTGATGTGCGATCTCGGCG
CGTATATCCCCGAGCACGGCGATGTTGTGGACGAGAATGACTACTTGCTGATGT