Description :
From Genome Similarity Track
Location :
Scaffold_620:13833- 15111
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_620-snap-gene-0.11Amino Acid-Polyamine-Organocation (APC) Family

Sequence
1278 bases(100 bases per row)
ACTGGCTGAACATGAAGTACGGCAACATCCTCGCCGCGCTCATCCAAGCGCTCAGTGTCGTCGTGTTGCTCATCGGTGTTCGTTTCGGCAAGGCCTTCGT
TAACACGATCACCATCATCAAGCTCGCGGTCGTGCTCTTCATCATCATTGCCGGTTTCGCGGCCATGAGCTCCGACAACCTGAGCCCATTCGTGCCAGAG
CGCAGAGACCTTGACGGCACAATGGCATTCGGCACCCAAGGTATCATCACGGGCGCCACGCAGGCCTTCTTCGGCTACATCGGTTTCGACGAAGTCTGTT
GTCTTGCTGCCGAAGCCCAGAACCCTAAGAAGATCATGCCGATTGCCGTCATGAGTGTCGTGTTCGGCACGATGGCGCTCAGTGTGTTGTCGTCGCTTGT
CCTGTCGGGCATGGTGCCGTACTTGAACGCCACAAGTTTCCCTGATGGGTTTGAAGGTGTCGGCTGGCACTGGGCTGCGAAGATCGTGCGTGCGGGTGAG
ACCTGCACGATGCCTGTCGTCGTGCTCATTGCTTTCCTCGCGCAACCTCGTCTCAACTACGCGCTGGCGTGCGACGGTCTCATGCCAAAGATCTTCGCGA
AGGTCAACGAATCGGGCAACCTGTTCATGAACACGCTCATCACGGGTATTTTCTTCACGATCGTCGCGTTCGTCGTGCCGTTCATCACGCTGTGGGACAT
CGTGAACTTTGGTATCCTCGTGTCGTTCATCCTCTCGAACGCGTCGTTGCTGATGATCCGTACCAAGGAAGCCTCGCCTTTGTTGGCGCCAAAGCTCATC
GGCGCCATCGTGCTCTTCGGCGGCCTCTCGGCGTTCTTCTACCAGCGTGGTTACGCCGACGGCGGTGACTCGGTCACGTGCCTCGTCATCTCGATCATCA
CGCTTGTCGGCATGGTCGCGTCCATGGTGGTGTTGTACGCCAAGTGTCCACAAGCCGGTAACGACCCAANNNNNNNNNNAAGGCTACAAGAACCACGACT
CGGACGTGTGCCTCGCCATCGCGGTCGTCGCTCTTGGCGCCATGATCGTGTCCACGATTGCGTTGTACATCAAGTGCCCACAAGCCGGTAACGACCCAAC
CAACTTCACGGCGCCACTGGTGCCGTTCATCCCGATGATCTGCATCCTGGCCAACTTTTACCTGATCTCGCAGATCAGCCACCTCGGCCTCGTNNNNNNN
NNNATCGGCCTCGGCGTGCTCTCGTACTTCCTGTACGGCTTCAAGAAGGCCGCGGGCCGCACAGGCTGGAGCGAGCTG