Description :
From Genome Similarity Track
Location :
contig_56:1383- 2529
Transcript NameFunction/comments
g8669.t1hypothetical protein

Sequence
1146 bases(100 bases per row)
AACCCGTTCGAATGCGGCGACTTCGTTTCTTTTTGCCACCAACAGCTCGAGCCAGGGTGACCAGCGATGGCGGAGGATCAGAAGAAACACGATCTCTCAA
CTCTTCCGATTCGCTATCGTCCTCGTCTCCACCCGACGATTCCTCATCTCTTGTATTCTTTTTCGTATTGGAATCATCCGTAGGGTCGTCGTTGTGGCCA
TCCTCATCACCAGAAAATGTATCCATCGCTATGACTTGCGCGATATCACTGCTTGTGGCCATTTCAATGGCATTTTTCGCGACTTCGACTTCACTAGCAG
GGACCAGCACTTCAAGCCCATTAACGTCGATTAGTTCCTCGGAATCACTGTCCTTATCATTTTGGACGCTGAAAGTGAGTGATCGACCCCGGTGCAACCA
CGCACTCTTTTCACTGGCAGTCGCATGCTTCGCGACCTCAAAGAAAATTAGCGCTGGTGCGCGTGCCCGTGTCGTAAAAACAGTCCCTTCTTCTTTTGCA
ATCGTAAGGAGCCGCTGCAGTGGGTCATCGCATGACCCTAGTGGGCAGAAAGCTCCTTCTGGCAACTCGAGTTTTTGCAATTCACGCCTCAATGCGTTCT
TACGTTCATGCGGAGGACAGAACCTTAGTCTTTCTGTCATCGTACACAGCTCTTCGATGAACTGAATCTGCGTGGTGAAGATCCGACGCTCTTCCCCGTC
ATCACGATGAGAATCTTCTGGAAGAGTATTGTTGGCAGTAGGAAATCTGGAGGAATTGAACAGCCATTAACAGCATCGCAGATTGCACCAAGCGGAATAG
TGGCCTTCGTATCTGTGTGAACGAGGATTAACAGGCGATCGAACAGACACTTGATGATGGCCGTTTGCTCTGTCGAAGCTGGTAGATCCTTGTCCGTTTC
AAAAGACCAATCTCCATGAGAAATCTGCATCTCTACGTTGATCATTAGCAACTTGCACATGCTCATCTTCCGGTACAGGAACTCGGGCACATACAACTCT
GACTGGCCGAAACCCCATCCACAGCTGTCGTCAATTGCTGCGCGGGTTAACCAGTAGATAGCAGTTGCTAAGCGGATATGGAGCTGAGTCGCGTAGCAAA
TCACTCGAAAAAGAAGTGCCGCTTTGACACTGTTGCTTGTCCAGTC