Description :
From Genome Similarity Track
Location :
contig_67:13820- 15329
Transcript NameFunction/comments
g11579.t1hypothetical protein

Sequence
1509 bases(100 bases per row)
TGTGTTCTGGCAGAGGTGGGGTCATGACTCACCAATGCTCTGCCAGAAGCTGGGTGCCGGTTAGCCTAGATGGCTTTCCGACACCAATTGCTTCAGGGTG
CGTGCGTCCATGGCACGGCGCACCCAAGCGGACGCCCTACTTGTCCACGACCACGTACGGGTCGCAGCTGTTCAGGTATGTGAACCTGACAGCAAGGTCT
ATGCAGACCATTGCCGATGCTCTCTCACAGAGAGTTGGCAATCGCTCCGGCAGTGTACGAAAGCATTCGGCGCCCCTGGAACTAAACGTTCCTAGGGATA
TTAACATCCCCGTACACTCACGTGTACTAACGGCAACCCAGCGTTGCCATCACCGATTCGAGACATAATGTCTCTCGTAGGCTAAGCCTCCATGGTGTGC
GCTACCCGCACACCCGTCACGGAGACTCAACTCTCCCCCCTCTGGGGAACCCGCCATTACTTGTGGCCGCCGTTCCCTCGGCCACCTGGCCGCGGCTTGC
GCCAGCGACCGTTAGGCCCTCGGGGTTTGAGGGATGGGTTCTTCCCCACCCCAGTCGAAGGACACACACGTTGGTAGTGTCCTAGTCCGCCGCATTTATA
GCAGCGGACCGAGCCAAGTTCAACAGAGCTCAAGTCCATAGGCTCTGGCTCGTTGTTCGCAACGACAAGTTGCGCAACAACCGGAGTGCCAGCGTGTTTA
TGGCTGTACTCCTCCTGGAGGGCGATCTTAATCGCCTCCTCCATAGTGGATTCATGCACGCGGAATAACTGCGTGCGTGCGGGACCGACCTTCAGGCCGT
CCATGAAGACCGCCGTCTTGACGTCTTCGGGCAGGGGGTTCCCCACCAACGATGATTCCAACGTGCGCATCTCTTGTACGTACTCGTACAGCTCGCGCTT
CCCTTGCTTACAGGCGAGGAAGCGTGAGCGCTGGCGGAACCCATCGTTCGCCGGGAGAAACGCAGCGCGAAGCCGCTCGCACAACTGTTCCCAGGATGCA
AATCATTCAGGAGACGTCGTCTCCAGCGTGTACGCCCAATTATTGGCACGACCGCTTAGGTTGGACAACGCGAACGCAATGCGAAGTCCCTGATCCGAGA
TGAGACCCGCCCTCATGGCGATCTCAACTTCTCGGATCCAGAAGTGAAGGTTTTCACCTTCCTTTCCTTCGAACGCAGGCACAGCCAGCCGCAAAGGCTT
CGGCTGGACCGGCTTCGGCTCGGCCACAGAGGCCTCCAGGTTTCTCTGCACGTGAGCAATGAGCTCACGTTCATACGTGTCGAACGCGTTCACGCGTTCA
ACTTGCTCGGCTGGCGTCAAGGACGCCAAGCCTCGGAGGACATCCCTCCCAAAGATGCCTCCCATCTTTCGAACGGACTCGAACTGCGAGTCGTTCACGT
GAGGAAACTCACTTCGTTCCATAGTGGCTCAGGCTTTGAGGTCACAGAGGATTCAGGTAGTTCAATCCTACCCGCGTAGGCGTGGATTGACTACAAGTGC
TACCAAGTG