Description :
From Genome Similarity Track
Location :
contig_204:13819- 18876
Transcript NameFunction/comments
g12069.t1hypothetical protein
g12070.t1hypothetical protein

Sequence
5057 bases(100 bases per row)
TCTGCACGCGCTTGCCGGTCTGAGTTTCAGCAAACGCCACAAACTCCGCGAACTTGGCAGCCACCTCGGACTTGTTCCTCAGCAAATACACCACAGAAGT
GCGACTTGTCGTCGATGAACGTGACGAAGTAGCGCTTGCCCCAAACGTTGGCGTCTGCATGGGGCCGCACACATCGCTGTGAACCACCTCCAGCACGTGC
TTCGCGCGGTTCGGGGACGACTTCATGTAGCTCACTCGCGTTTGCTTGCCGAGTGCACACCCGTCGCACAGCTCCCACTGCTTCACCGACGTCATGTCGA
TGCCAACACCGTAGCTCTTCTTGACGATGGCGTCTAGACCGCCATGGCCAATGTGACCAAGTCGGAGGTGCCAGAGGTACGACGTGGTGTCCCCTTGGCG
ATCCTTCGAACTTGCCGCATTGGCCTCGTCAGGCATCATCGGAGTCATGCACAGCTTGAACAGCCCTTTGCCCTCACGAGCGCCGAGCTGCCACTTGAGA
CCCTTGTTGTCCGCGAAGCACCCGTCGCTCTCGAAGGTCACTGGCCCGACGTCCTTGGTGAAACGGCCGACCGAAAACAGGTTGCGCGACAGTTTCGGGA
TATGCCACACATTCGTGAGCACACCCTTCTTCATGCCGCGCGGCGTCTTCATCGACATGACAATGTCGCCGGTCCCCACCGCCTGAACCACACCGTCGTC
CGCGAGATGCACGTCCACCGGAGCCATCTTCTTGTAGTTCCGCATGTACTTGCTGGAACTCGTCATGTGCTGCGTCGCACCCGAGTCGACCAGCCACATG
TCACTCGGCTTGGCGGCACTGCTCGTACGACCAACCGAGAAAAGGTAGTCGCCAGGATCTTCTTCGTCCTGCGCGACGTTCGCACGCTGCGACCGATATC
GCTCAGCGTCGTTCTGGACCCGCGAGGGACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTGGCACGCTCCGGTCTTCTTCACCGGTCGGCCCTT
GCGCTTGTTGTCTCTCGTCATGAACGCTTGACCTTGGCCGTGCGCGGCTCCGTCGACGCCACCGCCACCTTGTTCCTTGCGCTTCATGTCCTCATGCAGC
AGCCGAGACGTCACGAGTTCCCACGACAGCGAGTCGGCTCTCGACTCCAACGCCGTGATCAGGAACTGGTACGACTCGCTCAGACTGCCCAGAAGCGTGA
TCACCAAGTCGTCCTCGCTGACCGGAGCGCCAACCGCGTCGAGCTGCTCCGCCAGCGTCTTGAGCTTGTTGATGTGCTCCAGCACATCATCACCTTCGTC
CATCATCGTCGTGAAGAAACGCCGACGAAGAAAGAGCTTGTTGGCCAAACTCTTCTTCTTGAAGTGTCCTTCCAGTCTTGACCATGCATCATGCGCGTCC
TTGGCCGAGCGAACCTATCATTCCCATTATCCTGCACTACTTCTTGTCGAAAGCAGCCTCGGACTCCTGGCTGGTTAGTTCCGCACGCGTTAACTTGCCT
TCGGCGATCTCCAATAACTCGTGCTCCCGGAAGATCGTCCTCATTATCCACTTGTAACGCCGCCAGTCCTTGTCATCCCAGCCGTATGGCAACCCTTCAG
TCTTCGTCTCGCTGTTCATCCTGCTGAGCTTAAAACACGAGTCCTCTTGGGCTCATAACCCTGTTGGAAATCGGATCCTGTGTAGTCTAGATAACTAGCG
GTGAGGAAGGTGATGTGAGCTGGGTCTTGAGAAAGCGGAACTGCTGTATTCTACCACCAGGCCCTTTCCTGGTGGTTACGCCTACAGCTACCTCTCTTGA
TTTTTCTCATGTAACAACCCCCGTGGGCCGAGATATGCAGGTGGCTCAGTATAGCCACTTCAACATGCACCATCCCCGGGTTGGGATTTCAACGGTTCGA
AGCTGTCGAGCTCAGGTAATCACAATGAACTGATTTTTTTTTTAACTCGTCTTTTTATACAATATCGATCTTTTTCTAGGACTCAGGTGTTATTTTTGAC
CAATCAGCTATTTTATTTTCAGCTGGCTTTTTTTTGGTAGACATCGGAGGATACAGCAAGCACCCCACGAGCAAATGACGAGCACGACTCGTGAGGTTTT
TCCGCGAGCAATAAAACCTTACGAGCAGTGCTCGCGAGGTTTTTCAATTCGACCTCACTGATCACTTTTGGGGGGGAGCACGAGAATATCAGGTGCATTT
GCTCGTTCTCCGGCGCTTCAATTGGGTGTAAAAGACCATTTTTTAATTGGCCGTTATTCAGCGACGATCTTCTGCAGGCGTAAGTAAAATATAATCCCGC
TTTCCAGCAAGTCCGTCCGCCCCAGCAAGTCCCCGCTCCTGACGTCATGGTACTGACCCGGGCCCAGGCGAAAGCAGAAGCGGAAGCTCAAGCTGCGCGA
GGCGACGAAGACGATCACGTTGAAGACATATACGACCGCCCAAGCGCCGACGCTGAGTACCCTGATGATGAGACCGAAAACATGACCGAAGGGCCAAGTC
GCGACACCGCGTCGGCGTTAGTGGTGGCAGAGAAACCAGGGGCGAACATTTTCCCTGGTATTGAAGAACACCTCGAGAAACTGGCGGGGTTCTTTCTCGC
GCAAACGCGATATCTTGTGGAGGGGCACGCGATGCTGCAGTCCCAGCAAGAAGGGCAGAGTAATGTCCAGAGCGCCGCTCTAATGGCCATTCAGGGCTCG
ACCGAAACCTGCATCAAGCAGCTAATGGATCAGCAGCTTGCAATAGCTGGTCAGTTCCAGGAAGAGCTGATGGCGACTCAATCGGCCATCTGTGAACAGC
TTATGGCGATGCAAGCGCAAGCTGGAGAGCAGATCAAAACGTCTGTGACGGAGAAGCTCTTCAATGCGCTGCGTGAAATGCAGTGTGAGTCCCATGCGCT
AATATTCTCCCTAGCGAATAGAGTCAATCTACTGGAGACTCAACTGGCCGCCAAAATGGACGACATCTTCCAGATACTTACATCTCGGATCCAGCAGCTC
GTCGAGGAGCAGACGGCGGTACGGCAGCACGCGAGCACCGCTTCCGAGAAATCTGTCGAGCACGTTTTTGAGCTTTTGGAGAAGTCCATGACAGGCATAA
ACGCCCACGTGGAACAATCGCTAGAAAGGGGTTTACAAGTCGCGCGCGATGAACTAAGGCAAGAAGTATGTGCAAGCGCGGTGATCTCAACTGGAGAGTC
AGCACTCGACGCGGTTAAGCATTTAGTGGCGGCTGAGGCAATAAAATCAGAGCGACGTATCGAGGCACAAGTGCAGAGAGGACTGACGTCCTTCCAGACT
GATATACAACTTCAAGTTCAACGCCAAGCAGACGCAACTTCCATTCTGCGGGATCAGTTCCAGCAGCACTGCGATCGTGCTCAATTAAAGCAAGGGTCAG
TAGGTGAGGGACTTCGCAGTGACGACGCAAAGGAACTTGTGCGAAAGGAGGTGGACGAGTGCATGACTACTTTGCAGCGCCAATTCCATGCCGTGGAACT
CCAGGCCGTGGAACGCGAGCGACAAGCTGAATTACAAGCGAATGAAACGGAATTGCGTCAATTGCAGGCCGTGGAGCACGCACGTGAAGCCGAATTGCAA
GCGAAAGAGGCTGAAGTAAATCATGGTGTGACAGAGGTGATTGGAGAGCGTCTTCGGGATCCTGCAGCCGATATCTTGGCAGAGATCAAGCAATCACTGG
AGAGAAGCGTGAAGACGATAATTGAACTCATCAGTGTTGCTGTCGATGGCTACGCGCAGACAAAGGAGGAGATTAAGACAGAGATTGAAAATCGTGGCAG
CGTTAGTGAAGATGATGGAGATGAAAATTACGATGAATTGTCGGAAGAAGATCACTACGCACAACAGCGAATGCGGGACGCCCTCATTAGGCTCAAGCTG
CAAGCACATCACCGATGCCTTCACTCCGCCCTCATTAGGGCTCAAGTCGCAAGCACACCACCGATACCTTCACTCGTTGTGCATGTGGAAGGACCACTGC
TTCAAGATGGCGAGCGTTTTAGGAACAAATACAATCACCATGGATTTCCACCAGCAGTGCAAGGTCGTGCTACGCCATCTCACCGTGTTTGTGGCGGTCG
CAGAGGTGGTGGTCGCAGTGGGAGAGACTGCTGATGTCCTGAAGACCGCTGGAGAACCTCACCGTGGAAATGATACCGAGTCTGCGGAGGTGGCGAGCTG
GAATGGAGGTCGTCGTCAGACCGTCGTCTAAGAAAACGTCCCTGAACTCAAGCAGGAAGGCTGTTATCGCGGTGCCAGCGGTGATAAACTCACCGTGAGA
AATATACCATAGTTGCCGAGGTGGTTGTGTCATGCGAGACGAATACGAGGATAAGACGAAATAAACGTAAAGCATATGGTCACACAAAAACATATATTAA
ACACAGTGAACGTGAAACTACGAGTTCGTGAAACTACGAGTTCTCATTCTACTCCTCGTTCAAGCTGAAACTCGTGCTCGACATGAAGCCAGCCAAGATA
TCATCAGAGAAATCATCCTCCATGTCCCAATCCAGATCCAGAGGGTAAATGAAGCAGGAGGGCGTGTGCTCGCGGTGTTTCCCCCTTTTGATCGCCTCAC
ACTGCAGTAGATCCACAAATTCGTCGTTGCGGTTCAGGAACGTGGCCATGTCGATGTTGTGTTGCGACAAATTGGTACGTTGTGACGTAACCATACTTCC
GCTAACGCTGAAGTCCCGCTCAATCTGGCATGATGATGCTGGGATGGCAAAGAGCACTTTCACTGCACGCGGTAGGAAGATGTAGTATTTGCGGTGCTCA
ACTCGCCGCCAGAATGACAGAACCGATTCAGGTGCACCTGACTCCGACCGTTCCACCTCAATTGGGTCGTATTTCCAGCGATCCAGCTCTTCGTCCACGC
GTCGCCGCATTTGATTCACAGTGACGGCCGCTGATCTGCGCGGGGGAGGGGCAAACATTGCCTCGAGCTCACTATAAAACGGGGTGGGACTTGGAGGAGG
TGGCTCGACTGCATCACTTGGATCCGCTACATCGTTCAGCAAGGTGTGTAGCCGATC