Description :
From Genome Similarity Track
Location :
contig_147:13819- 18873
Transcript NameFunction/comments
g11699.t1hypothetical protein

Sequence
5054 bases(100 bases per row)
GGGAGCTTCCATATGATCGCGCTGTAAGCCCCACCGCTACGTTTAACACGTGCTGATCCATCGAAGCTCGCGACTAACAAATTCTCGTCCGCTTCAACCG
TAGGGGGTGGCATGAGGATCGTTTGTCGAGGCTGTTTCACCGGCGCAATCGCGATCAGCGCTTCGTCTACTTCAGCGCGAGGTGTGATGCTTGCTGCAAT
CGCACCCAGGATTTCATCTTCCCCTTTCGCGCATTTCCGGATCTCTAACGTCCACTCTGAGAGCAGCGCAGCCCAGTTGCCGAGTCTTCCCTGGAAACCG
GCTGAGTTGACTAGCCAAGCCAACGTCGAGTGCCTGGACAACACCAAGATCGATCTCGTCGTCAGCAAGGTGTAATTCACGTCCAGCATCCGTAAAAGCG
CCAAGACTTCCTTGTCGACGATTCCGTAGTTGAGCTCGTTGGACTTCAAAGTACGACTGGTGAAAGTTACTGGCCAGTACACGCCATCATGCTCTTGCAC
AAGTGCCGCAGAGATCGCCCACTGACTCGCGTAGACCACGATCACTGGAGTGCGATCGGGATCGAAATGCTTTAGGATCGGTGTGGACACGATTTTGGCC
TTCAGCATTGTGAACGCGATCTTCGCTCGGGTCCAGCGATCAGCGTCCGGAATCTGTGGTTCGTCGCCCCCAGTCATTTGTCGGCCAGGGTTGACCCTCT
CTAGACGCGATCTCATGAAAGTCCGCTTCGCGCAGCTCGTACAAGACGGCGGCGTAGATCGCGAAGTCTTCAATGAAGCGACTGTAGTAGTTCAAGCTTC
CAAGGAAGACTGCATCGATCGCAGCGTCAGCGGGAAGGGGAGATTACTCAGCGCCTCAAGGTCCTTCGGGTGAGCTTCCAAACCATCAGCAGACACCTGA
TGCCCAAGTAACCCACCTTGCGCTGGCCCCAGAAGCTCTTGACGACGCTGATCGACAGATTCCACCGTTCGCAAGCGTCCAACAACCTCTCAACCTTTTC
ACATAAAGTATCCCAAGTGGTCGCCGTAACGAGAATGTCGTCGATGTACGACCGTCTTCCCAGCACGGACGGCTTCAGTTCCGGCTCTGGTTCCCCTGCC
TCGAACACATCAATCGGCGTCGACAGATCATGGCTAGCGCTGATTCGGAGATGACCATACAACGCATTGTCGATGAGCCTCTGATAAATCTGTGGAGCGT
TCTTCAGCCCAAAAGGCATGCGCGTCCACTCGAAAAGTCCGAATGGCGTGACAAAGGCAGAGATCTTCCGAGCTCGCTCAGTCATAGACACCACCCAGAA
ACCACTGGCCATATCGAGGGAGCAGTACCAGAGCACCTTGTCCAAGTCTTCCAAGAGATCGTTGATCATCGGCATGGGATATACCATCAGTCGTGTCAAT
CCGTTCACCAGCCTGTAATCGATACAGAGTCGGATGTCAACACCGTTCTTCTTGATGATGATCACGATCGGGGATGCCCACGGCGAGGTCGACGGAACGA
TCATCTCCGCAGACAGCAAACTCTTGATCAGGTCCGACAGCTTCTCGCGAAACTGTGGGGCGACCCGGCGAACGCGTTGGGCGACCGGAGTTGCTCCCCA
ACGTCGATGTCGCACACCGCGCCTACAGCCGCCGGGGTAACGCGTTTCCCTTTCCGATCAGTAGGTGACGCCGGCGCCAGATGATTTGCCGCAGACGATC
GATCTCCTCAGGGGTGTTGAAATCAGGGTCTCCCACCTGAATGTCTTCGATCGTGACTTCGTCGGTAGTGGTTGCTACCTCAGGCAAGACAGCCATCTGC
TTTTCCACGTCCTCCGCGAACAAGTCGCCTCCTTCATGGTAACAGACTTCGTCGTCATCTGGTATCTCCGACTCGGTGATCGGCGGCGTCTTCGGCTCGA
TCATGGGCGCTCTTCCGATAGGCATCCCGTCGCTTCGCTCTTCCATTCTGTCTGACGACATCTCCGTCGCGATCGGATTACCCTCTTCGTGCGCCCATTG
ATCCCGGGGGCATTTGTCCTCGATTTCGTCTCAACAGGGCGGGACTCGGTGATTTGAGCGACGCTACTTTCGACGCCCCGGAGTCTCGACTCCAGATCTT
CGTCGGTGTGACGTACTGGGGTCGGTCACCATCGGTCCAGCGGGTCTCGTGTCTGGTTCTTCCTCGGGTTGCTGATCTGTGTGGCTTGAAACGCTAGGTT
TTGCCACTCAGCATACCGGCGTGACCCGATCAGTACGAAACCAGGAGCGGGGTACGCGTCCTCCTTCGAGCCACATGCCTATGTGGGCATCGTCTTGCAA
CACTAACTTCCGATCGCTGATGTTCGTGATTTTCAGGTAGCGTGTTTTCCCTAGTCCAGCAACCAAACTCGGCACCCATCGTTCTCCTCGGGTAACCCAC
AGCTTTCGGTGGCTCGACGGAATGAAGCCCTTCCGGACTTCGACCGACGCTCCGACTTCCAACTGACAGTGCTCGCCGAGCCTGACTTGCGACACCTTCC
CCCGTAGAGCTGACGTCGACCGGCTATCTGAATCGCACCTCGTCCGGAAGATTTATCGACCGTCAGCCAGATCGAGGCGGATGCCAGCCGGCACCATGAA
GTCCATCCCCAGGATTAGGTCTTGGCCACCGGTAGGTGGACCAACCCAAACGTCGAAGTAGTACACCAGTGATCCCGCGAGCGTGATCTTGATTCTGGTA
CGTCCTTCCGCCATGTAGGGATTCTTACCAACTCCTTCACATTCCAACTCTTGACTATTGTCCACGTAGCACCCAACCTTACGAGCAAAGGCGGCATCCA
GAATGGACACCTCGGCGCCACTGTCAAACAGCAATGTGGCTCTTTCGTTGTTGATCTTCCCCACGGCTTTCGCCTGCCGAAACTTCTTGTCCGGCACATG
GTACTTCCAATATCCTCGTGACTCTCCGTGCAGGAGATCCAAAGCCATCGTCACCTCCGACCGCGAGTATTCGTCGACTTGATGGAGGCTGGAGATCGCC
ATGGTACGTTTGTCATGAAGATCACATGTATTGTCGGTCGGCCGAATCAGCTTACTCACCTCTGACTTCGACTGTTTTTCGACATATGCATAGATGCAGA
ACTGAGAACGCTCGTCTCGTACCGGATTCAAACCCGGCGAGCGTTCTAGTTTAACATCTTTTCGGCCGCTTGCGGGAGCATTCCACCGTGCTTGTTCGGG
TTATACCATTGACGGATCAAGTTGTAAAACTCCTCCATCGGGCATTCTCCAGCTCCGTGAATCTCGCCGCAGGCCTTGCAGACGAAGAGGCAGCGGTCAG
TAGGGTGACCCTTCTTGCCGCACTTCTCGCACGTCAGACGTTTCCAGCAACCAAGATCGGTGTGCTTTGACGAGCCGCAGTGGGAGCATGGCTTCCGCGG
GACTTCTCCTTCAGGAGGTCCGGCTGGACGATCGAGGCGGCGGTCGTTGGAGTCTCGACTAGGACGGCGTTGATCCTGATCCGATCGCGATCGGGTCGGC
TGATCGGGTGTTGCCGCAAAGTACACCTTGCGCAGATCTCCTCTCCCTCCGATCCGCTGGTTTCCGGTTCGGACTCACTCGAGTTAGCCGTTGCACGGAC
CGTACGAACCGCGCGAGTGTTGGCGGATGGGGTGATCCCCGGGGCTTCTGCTTGGGTTTGATGGACCCATACACCGTTTTACCTTGCCTCGCCTTCGCGC
GTTGTCGGGATCGCAGTGTTTCTTCGAGAGTGTCTGCGTCCGGGATCCTCAAAGCGCCAATTGGCTGGCCAGATCCGGTCGTCGAGCGTTTCGATAAAGT
GGTCGACATGCTCACGGCGAACCTCGATCGATCCATCCTTGATCGAGAGCTGAGCTCGCAGTCCAGCGACGTTCAATCGGTGCAGGTATTCCAACGGTGA
TTCATCCGATCTCTTCCGCGCATGGTAGTATTGTCTCGCGACGATACACCACGCCCACAGTATTGAGTCTGGAAGTTCCTGGACAGGCCCTTCCAGTCGC
CACGCGTCGTTCGACTCAGCTGTCGGTACCAATTACGTGCGGGCCCAGTGAGCAGATCTCCAAACACCAGACACTTCTCGCCATCAGGAGCTTGATCGCG
GATAAAAGCAGACTTCAGTTTGCCGAACCAGCTTCTGGCACGATCTTCGTCGTTATCCTTCCCGGAGAATTCCTTCAGTTCCGAGATCGCGGAGACCCGG
ATTCGTGTGGCGAGAGAGTTCCGCCGCCAGTGGCTCCAGCAGAAGCAACTGCGGCACGGGGAGCAACTCCGACGTTCAAGTCGTCCGGATCGTACTCACT
TGGATGTGAATGATCTAGGCGGTTTGATCCCACGGACTCCATGTCCACGTCTTGAGCTCCGGTTGGACTGTTCCGAACGGCAGCTGGCGGCGTCACGGTC
GCTTGCTGTTCCTTCAGGAAACGCTCCATCGCTGCATTAAAAAACGATTGCATGCGTTCGGGCGGCGCTTGGACTGGATCGCTCGACGCGATCACTGTCG
GCTTGGCTTCCGAGCGCTCTTTTCGTGATTGTAGCATGGTTGCTCCAGCCGGTCCAAGCGTCATCCGCTGCAGCTCGATCGAGCTGTCCGATCCGCTTCG
ATGTGGCTGAGGCATATTGGACGATCCAGTTTGGCTGCGAGTCGGTGTTGGTCTTGCACGTTGAACCGGGACGACGCTACCGACAAGGGGCGTCAGTTTC
GCAAACAGGTTCAGTGTTGATTCCCTGATGACTGGCAACTCCACGTCGAACAACTCGTTCGCGTCGAAAGAGCCAAGCACGATCCCTGCTTCTTTCAGCA
TACGCATCAGAAGTTTCACCGCCTCAAGTTGGCTGGTTACTTCCTTCGGTGCCTTCACTGGGCCTTGAAGTTCCCCAATTGGCTTCGGACGCACGATCTT
CATTACAGGATCTTCGTGCAGGAACTTGTACAGGTCCTTGTAGAAGAAGGCAGACTCCAGTTGCTCGTCCGTCCACGTGTTGCGATCCTCCTGGTCTTCG
GCTTCAGACTCCGGTGCCTTCAGCTTCTTGCGTGAGGTCTTCGACTTCTTCTTC