Description :
From Genome Similarity Track
Location :
Scaffold_93:138178- 140561
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18876voltage-gated potassium channel subunit beta
Phypa_INRA-310PPTG_18877protein kinase

Sequence
2383 bases(100 bases per row)
CTTTGTCGGCGGAGTGTTCACCGCGCTTCGCCACACAGTTCTATCGTGTACTACTGACGAACTTACCGAACGATTTTCATCGGAACGGGGTGATCTTGTC
CACTAACTCCAGCGCCTTGATGTTCTCCTCCAGCTGAGATGGATGACTCGCACCGATCATCACAGCCGAGACGTTCTCGTTCGAGACGGCCCATGCAAGC
GACATCTGCGCAAGCGTGCAACCGAGCTCCGTCGCAATGGGTTTGAGCTGGTCGGCCATCACCACGCGTTCCTCAAAGCTTTCAGACAGTTCTCCTTCAG
TGTACATTGTTGTCGTGAAGCGTGAACCCCCCCCCCCCACTGCTTACCGGCGCTGTACTTGCCAGTCAGAGTACCGAAGGCAAGCGGAGACCACGTCGTC
AGACCCAACTTGTACTCCTTGTACAGGTCAGTATACTCGTGGTCCACTTTGTTGCGCTCAAGATGTTGTACTCCGGCTACTCCGCGATGGGGCGAATCAA
CCCCAAGCGGTCTGCGATCTTGCACGCTTCACGAATGTCGGCAGCGAACCACTCGCTGGTACCCCACCCAGTAAAAGGCACAGCCCTGAAATTCATTGCA
CGAACAGCTTCCTCAATCGGAGTGTATGGTTCAGGGCGGTGGTAGTAGATGATGTCCACGTAGCCAAGCTGTAGATGGCCGAGTGCAGCATTCGTGCCCT
CCACAATGTGCTTGCGTCCAATATTCAGCCCGGAGTCCTAAATTCCTTGAAACCTCCGAAAATCTTGGTTGTGATCACCAAATCTTCGCGGTTCCACACT
CCTCTTCAATGATGGCACCACCCCATGTTTCTTTCGGACTGGCCGGCGCCGTATATCTCGGCAGTATCGAAGAAATTGATGCCGGCTTTGAATGCAGTCT
CCATCATGGCGTACCTTGCATCCACGGTGTACTTCTCGTAGTATGGCATCCATGAGCCAAGACCAAACTTAGAAACGATCAGACCAGAGTTGCCAAGGAA
GCGGTAAGTCATCTTGGCGGTTGTAGATGAGGTCGACATGGCGATGTTCGGAGCGAATGGAACGTTCGTTGTGGTTTTTGAGGTTTGGAGTAAATCAAAA
GTGAGATCTGCAGAAGGAACAGTCTCGTGCAAAGCAATATCGAGTAGCCAATTAATTATGTTAGGCCATGGTTTGACTTTGCTAAACGGCGGCATAGATA
CATTGCGTATTGAAATGAGAACACGAGCCCCTTGCTGACGTGCAGTTCAGTGCACATAATGCCCGGGGATTGCTTTACCGACACGACCATCTGAGAATAC
CAACACTTGATACAAAAAGAATAGATAATCATTTGACCGACTGTGGTCGATTTCTTAAGCAATTGCGTTTGAAGTAGTTTCTCTAGAGGTGAACAGTAAT
TGAGCGAAGCATGTATTCATGAACAAAAATGTTCTGAACGATCGAGCTTATAGGTTGGTTTGCATTTTTCAAAGTTAACGAACTACGGTATCCGTCAGCA
CTAAATCACAGCAGCATTCACCTACTGTCCATCGGTGTTGCCGCTTTGGATAACACTAACACGAAGGTAGAAATGAGCGTCAACACACCCCTTGGACTAC
TTGACCAGAGTTTAGAACTTATTCAAGGATCTATTAACAAAGATAAATGATCACATCTACTACTACTACACGTCTTGGTTGCTTCATTGACGTTGGTCAT
ACTCACTCTTGGCTTCTCGGACTGCGGGTGATAAGGACAACGTCTGGGTTAGCACCAAGAAACTTATTACAGTAGTATAAGATCACTCATACACTCGTTT
TATTAATTATTAGGTGTGTCGGCCTCCTTTAATCTTCTTTCGAGCTACTGCAACAAAATGCGTAAGCCGTGAAGCCGAGCTGCATGATACCGCAAAAGTG
GGGGAAAAATGCATTTCTGGGCTCGAATTGGTGCAACTAATCGATAGGGTCTCATGAAATATTAAAAACGAGTGGATCGCTTCACGAGTGCTTGATTCAA
AAATAACGGTCGAGAACTGCGTAGAATAGTCGGTCATCTGTGGCTCCACCATTTCCATAGGAGGTGAGGAACTCGAATGAACTTGTTTTTCCATAATCTT
TTCCATCGTATGGACCGATTTCACTATATTCCAGAACGAATTTGCTGATCACAGCTCTGACCTCTGCCCAGGTCAGATATAGCTTACATCCGACGTTGCA
GTCATGTTGCGGCGATTATCTTTGCTGCTGTCCTATTCTAAGCATCGTCATCTCAAACAGAACACTCACCCTCGTCATTCTCGTCTCGTCCTCGTATACG
AATATATTTGTTGGCCTTGGAGGGCAAAAGCCCACATAGCGTGGCTTAACGCCTTTCGAAGGCACAACTCTCAAGATCGGCGT