Description :
From Genome Similarity Track
Location :
Scaffold_33:138167- 139640
Transcript NameFunction/comments
Albla_Nc14035120DNA replication licensing factor MCM5 putative

Sequence
1473 bases(100 bases per row)
CTTGGCGATTGAGATCGTTTGCTGTCCCATTGCTTCGTGAATAGCAACTCGATCGGATTCTCACATTTTATCGAATTCATCGATACACACGAGTCTATCA
TCGGCGAGAACCATGGTGCCACCTTCGAGATAGATTTCTCAACGAGCATCTTTGATGACTGGAGCGGTTAAATCAGCCGCACTCCTTCCTTTAACTGAAG
TGTAGACGCCAATCGGTGCGACTTTTTCCGCATTGGCTCTTGGTGGTGAAAGGATCGCCGAGTAGAGACACATTGATATCCCCACGAAGCTGAGAGGAAA
AGAGAACTCGTCAATATTTGAGGTGAGAGGGAGAAGGAATGACGTACGATCATTCCATCGGGCAGTCGCTTTCGTGAACCACTAACCAAAAGACAAGCGA
CGGTTACCTTGATGTCATTCGTGAATTCTACATGAATGGATGGAGCAATATTTTTCGCCAATTTACAGTATAAATTTCGATCGCACGCCATCTCATGAAA
CTGCTCTTCATCCACCGATGTAAAACTAATTCGTGCTCGTCCAGCGCCATTTTCGTCAAACTACAATGTCAAAATCAGATGAGAGAAGACTTGATGAAGC
TATGTAAACTTGCTTGATTTCCCACAACATGAAAGTAGATCAAACGAAGTGCGGATCCAGGTTATTTTGTGGATGCGTTTACCACAGATGTGATACCAAT
GATCGATACTCGTGAGCCCGGAGAAGCTTTATCCACAAGCTTTCGATCCGTAACAGCAGCGATATTTCTTGGCATTTCTCTTGTCGGTACCACTTCAGGG
CTCTCTTGTATCTTGATCTGGAACAATAATGTACGAACCTTTTGGACATGAATCTGTGGTCATAGTTTGTTGTTGACCACGCTCTTCCAAATTTCGGTCA
CAATTACGCGGAATACGGATACCACCAAGTCCATCAACTGGTACACGCTGTAGATTCCCCCAACTTCAACATTTCAGCATCGCCAAAGTGCACTTTGTGC
GTACTCGAGTCGCACTGATAAAAATCCAGGAACCTAAATGCATTCATATCAGAAGAATTCACTCTTCTTCTCCTTCCTTTAGCGATAACTTAATCAGTCG
ATTGATCTCGTGAGCGTGAACTTGACGCAGCGCCGATGGAACCTGATCACTATTGGGAATCACTTGAATATCCGGTACGTGATCCTGATTCGATACATCT
GACTGCTTTCCTGGCCCAAAAGCGAACTGGAATTGACCTCTGACGCCTGAATCCTCAAGATCTGCTTGAGTTTGTGTTTTGCAGCGACTTCGAGTGAGAA
TAGATGCTCTTTTGGATTATGAAGCAGCATTTCTTGTAATATCGGATCATAGAAAGCCAAATGGGTGAGATGAACCGTGCAGAAAATAATTTTCGACGGT
AATTTCCTAGCATTTGCTCGCAGTAATGAAATATTGTTCCCACACGAAAATTGCGCAAGAAATCATGAAATCG