Description :
From Genome Similarity Track
Location :
contig_67:13813- 15321
Transcript NameFunction/comments
g9827.t1hypothetical protein

Sequence
1508 bases(100 bases per row)
TGTGTTCTGGCAGAGGTGGGGTCATGACTCACCAATGCTCTGCCAGAAGCTGGGTGCCGGTTAGCCTAGATGGCTTTCCGACACCAATTGCTTCAGGGTG
CGTGCGTCCATGGCACGGCGCACCCAAGCGGACGCCCTACTTGTCCACGACCACGTACGGGTCGCAGCTGTTCAGGTATGTGAACCTGACAGCAAGGTCT
ATGCAGACCATTGCCGATGCTCTCTCACAGAGAGTTGGCAATCGCTCCGGCAGTGTACGAAAGCATTCGGCGCCCCTGGAACTAAACGTTCCTAGGGATA
TTAACATCCCCGTACACTCACGTGTACTAACGGCAACCCAGCGTTGCCATCACCGATTCGAGACATAATGTCTCTCGTAGGCTAAGCCTCCATGGTGTGC
ACTACCCGCACACCCGTCACGGAGACTCAACTCTCCCCCCTCTGGGGAACCCACCATTACTTGTGGCCGGCGTTCCCTCGGCCACCTGGCCGCGGCTTGC
GCCAGCGACCGTTAGGCCCTCGGGGTTTGAGGGATTGGTTCTTCCCCACCCCAGTCGAAGGACACACACGTTGGTAGTGTCCTAGTCCGCCGCATTTATA
GCAGCGGACCGAGCCAAGTTCAACAGAGCTCAAGTCCATAGGCTCTAGCTCGTTGTTCGCAGCGACAAGTTGCGCAACAACCGGAGTGCCAGCGTGTTTA
TGGCTGTACTCCTCCTGGAGGGCGATCTTAATCGCCTCCTCCATAGTGGATTCATGCACGCGGAATAACTGCGTGCGTGCGGGACCGACCTTCAGGCCGT
CCATGAAGACCGTCGTCTTGACGTCTTCGGGCAGGGGTTCCCCACCAACGATGATGCCAACGTGCGCATCTCTTGTACGTACTCGTACAGCTCGCGCTTC
CCTTGCTTACAGGCGAGGAAGCGTGAGCGCTGGCGAAACCCATCGTTCGCCGGGAGAAACGCAGCGCGAAGCCGCTCGCACAACTGTTCCCAGGATGCAA
AGCATTCAGGAGACGTCGTCTCCAGCGTGTACGCCCAATTATTGGCACGACCGCTTAGGTTGGACAACGCGAACGCAATGCGAAGTCCCTGATCCGAGAT
GAGACCCGCCCTCATGGCGATCTCAACTTCTCGGATCCAGAAGTGAAGGTTTTCACCTTCCTTTCCTTCGAACGCAGGCACAGCCAGCCGCAAAGGCTTC
GGCTGGACCGGCTTCGGCTCGGCCACAGAGGCCTCCAGGTTTCTCTGCACGTGAGCAATGAGCTCACGTTCATACGTGTCGAACGCGTTCACGCGTTCAA
CTTGCTCGGCTGGCGTCAAGGACGCCAAGCCTCGGAGGACATCCCTCCCAAAGATGCCTCCCATCTTTCGAACGGACTCGAACTGCGAGTCGTTCACGTG
AGGAAACTCACTTCGTTCCATAGTGGCTCAGGCTTTGAGGTCACAGAGGATTCAGGTAGTTCAATCCTACCCGCGTAGGCGTGGATTGACTACAAGTGCT
ACCAAGTG