Description :
From Genome Similarity Track
Location :
Scaffold_93:13813- 14961
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_93-abinit-gene-0.45Mitochondrial protein surfeit 1/SURF1/SHY1

Sequence
1148 bases(100 bases per row)
AAAGCGTCAAGATGCTCGCACGTCAATGCCGCAAAGCGCAAGCGCTCGGCGCACGTGTGCTGAAGCAGCAACAGCAACAGCTTCGCTGGGCGTCTTCCGC
GGGCGCACCCTCCTCCGAGACTACTACTGCGGCTGCTGCAGCTGCGAACGCGAGACAAGCGAGTGGTGGTGCATCGAAAGAGAGCAATTTCTCTCGCTAT
GCCGGCATGGCGTTTTTCTCCACGATTGTAAGTCTGTGTGTGCATGAAGATGTCTGACTGTACATACTTGCTGTATGATGGCATACATATGCGGGCAAAT
TGAGCTATAACCGTAGTTTGATTGCTAATGGGCGGTATATGCATTTTCGGTGTGAAGGTTGCAGGAACGGCGTACTTGGGAGTGTGGCAGGTGAGTCTGA
GATTTCTTTTGCAAAGGGCATTTATGAAGCAAAAGTAGACACCGAGATGACGGCAAGGAAAGTGTAACAAAGCGATGTTCTGTATTGCTGCAGACGCAAC
GGTACTATTGGAAAGTGGATTTGATTGAAGAGCGCAAGCGCGAGCTCCACGAGACTGTCGTGGACTTACCACAGGATGCAACGGCGCGAAGCAATGTGTA
CGTGTCTTGTGTTTATTGCAAAGCTCTCTTCTGGAGAGGGTATGCTAAAAGGAAGTCGTCCATTGCATGTAGGGACGATATCGAGTACCGCCAACTTCGT
GTCGAGGGCAAATACAAGCCTGACAGCACCTACTACTTGTGTAAGTACGCCCATTGACGAAGCGTATGACTGTTTGTGGGTGAAATGTTGACTTGCAAAC
TCTCTCTATAACGCTGTAGATCCTCGCTCGGCTCCAGCTGAGTCGACTGATTCGGTTGCGGCTGTCAAGTCTGGCGGATATCTTTACTCGCTCTTGGAGC
GAGACAACGGGTACGAAAATTTTGCTTTGGAGCGGATAGAGTCAATCATTGTAAACGTAACACCTAACATATGCATTGCTTGTGCACAGCACTCCTGTCA
TTGTGAACCGAGGATGGTTGCCTCGCAAGTTGCTGGATCAGCACATTGCTAGCAGTCACAAAGAAGGTGACGGCGAGGTGTCCATCGTGGGAGTCCTTCG
TCACGGCGAGGAGGTACTTTGCAGCTGTCTAATAGTTTTGACCCTATT