Description :
From Genome Similarity Track
Location :
Scaffold_504:13812- 16021
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_504-abinit-gene-0.20Myosin

Sequence
2209 bases(100 bases per row)
CAACGCCAACGGTGTGGAGGACATGGTGAACCTCAACTACCTGCACGAGCCAGCGATCCTCTTCAACCTGAAACAGCGCTTCCTGCGCCAGATCCCGTAT
ACGTACACGGGTCCGATCTGTATCGCCGTCAATCCTGTACGTACCCATCTGTGTTGCTCTTTTCAAATGAGCTCTTGGCTTATTGACTTGCGCAAACAAA
TACAAAAATCTGACTTTTGCTTGTTTTTATCCCCTCTCAGTATGCATGGCTGGACATTTACACAAAAGACGAGCAGGAGCAGTACCTGGAGAAGGACCGC
AGCGAGCTGCCGCCGCACGTGTACGCCACGAGCGCGGGCGGCTACCAGCACATGCGCACGTTCGGCGAGGACCAGAGTATCCTCGTGAGCGGCGAGTCCG
GCGCCGGCAAGACCGAGACGACCAAGATCCTCATGTCCCACTTGGCGGCCGCCGGCAACAACGACCTCGCCAACAGCAGCAACACCAACACAAGCGACAA
GGAGACGAGCATCATCGAGCGCGTGCTGGACGCCAATCCGCTCATGGAATCGTTCGGGAACGCCAAGACGTCGCGCAACGACAACAGCTCGCGCTTTGGC
AAGTTCTCGCAGCTCCAGTTCAACAACCTGGGCCAACTCATCGGCGCCAAGTCGCAGACGTACCTGCTCGAGAAGTCGCGCGTGTCCATGCAGGGCCAGG
GCGAGCGCAACTACCACATCTTCTACCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGCGTGAGCGAC
GGCATGAAGGACGAGAAGCGCTTCAAGCAGACCGTGTCGTGCCTCGAGACCATGGGCGTGACGCAGGACGACCAGCTGAGCATCTTCAAGGTCGTCGCCG
CGATCCTGCACCTCTCGCGGCTGCAGTTCGCGACGTCGGAGGGCAACGAGGACGCCTCGATGCTTATCGAGGACCCGGCGAACCTCAAGGCCAAGGCGAT
CGTGTGCAAGCTGCTCGACTTCTCCGAGGACGAGCTCGAGAAGGCGCTCGTGACGCGCCAGATGTCGCTCTCGGCCGTCACCGAGACGTACCAGGTGCCG
CTCAACGTGTCCCAGGCCCAGAGTGCGCGCACGGCGCTAGGCGTTGCGCTCTACTCGCACCTCTTCGGCTGGCTCACGAACCGCGTCAACATGTCGACGA
GCGCGCCGGCGAGCGACGTGGCCAACAAGATCTGCATCCTCGACATCTTTGGCTTTGAGATCTTTGAGAAGAACTCGTTCGAGCAGCTCTGCATCAACTA
CGCGAACGAGAAGCTCCAGCAAAAGTTCACGCAGGACGTGTTCAAGTCGATCCAGGTCGAGTACGAAGAGGAGGGCATCCCGTGGACACGCATCGAGTTC
GCCGACAACGCCAACGTGCTCGCGCTCATCGAAGGTCGCTTCGGCGTGCTCTCGCTGCTCAATGAGGAGTGCATGCGCCCCAAGGGCAGCGACGACGCGT
TCGCGAACAAGCTCAAGGCCCACTACAACGACAACGACCGGTTCGAGAGCCCGCGATTTGCGCGCGACGCGTTCGTGATCAAGCACTACGCCGGCCCCGT
GCAGTACGACACCAAGGGCTTCCTGCTCAAGAACACGGACGCGCTGCAGAACGACCTCATCGTGCTCATCCGCAAGAGCCAGAGTAAGTTCGTCAAGGCG
CTCTTCCCCGAGGAGCACGTCGGGGACGCCATGACGGGCGTCGCGGGCCACCCAAAGACGACCGGCCGGCCGCAGCTCAAGCGCCGCACGTCCATCATCT
CGGACACGGTCGGGACGCAGTTCAAGAGCCAACTCAACGGACTCATGGAGGACATCCGGCGCACGAACGTGCACTACATCCGGTGCATCAAGCCGAACGC
CCAGAAGAGCGCGAGCGTGTTCAACAAGCTGCGCGTGACCGAGCAGCTCCAGTGCGCCGGCGTCGTCGAGGCCGTGCGCATCAGCCGCATGGCGTATCCG
AACCGGCTG