Description :
From Genome Similarity Track
Location :
Scaffold_322:1381- 7135
Transcript NameFunction/comments
g10059.t1hypothetical protein

Sequence
5754 bases(100 bases per row)
GCTGCGTGGTATTTCTTGAGTCGCCCGACGTAGAACGTCGGGTGTAGTCGTAGGGAAGATGGTATGTCCAGTGTGTAGGCATCACCGATTACCTTCGTAA
CCCTGAAGGGACCAATGAAGCGCGGCGCGAGTTTGCTCGCGCCAAGATTCGTTACGGCCGAAGAGCGTATGCCGTCTGTCGACAGGAGCACGCGATCTCC
TGTCGTAAATGTAGCCACGTTCTTGCGCCCACGCTTGTCGGCGTTCTCCTTCTGCTTATCCACTGCTTCTTGCAGTGCATCTCGTACAAATCGGGTGACC
GATTGTCGCTGCAGCACGAACTCAGAGACGGCCGCATCATCGACTGGACGCGCCGGAGGCTTCGGCGCGTAGTTAGCTGCGACGGGATCGGTAGCCGGGC
CAGGGTTGATTAACGTGCGCGCAGTCCAATCTGTCAGTGAAGACACCGCGTTGTTCGGCGTCGCAAGGGTCCGTCTCGACTTCGCGCGGGTGACTGCATT
CGGCGTCACGGACTGGTGGGCTGCACTCGACAAGGGAGCTGGTGGTGATGGTGTGCCATCCGTGCTCACCACTGGTAATACCGGTATCGGTATCGGTGTG
TTTGTGTTCGTACTACCAGCACCATCATTTCCTTCCCCACCCAGAGTGGAGCCACGAGGCATCGTGGGGTGGCCCACGGCGAGCAGAGCGGGAACGCGCG
GGTGCCGCGCGTTATTTACAAAAAAAGGGGTCAGACCCGTCGATGCGTGTTCCGCGTTGTTTAGCGCAAACTCGGCAAGCGGCAAAAAGGAGCTCCAACT
AGTGAACGAAGTCGCGTAACTTCGAAGGACATCTTCGAGGACTCGGTTGACTCGCTCCGTTTGACCATCCGTCTCCGGATGCGCCGCCGTTGACATGAGC
AGCTTCGTTCCCAGAAGTTGGAAGAGACTCGACCAGAATGCCGACGTGAACCGCGGATCGCGGTCAGAGACGATCGATTCAGGTAAGCCGTGGTGTCGAA
AGACCGCGTCAACGAAATGCACCGCGGACTCAGCCGCGGTGATCGTGTCGGACACCGGAATGAGATGCACCATCTTGCTGAACCTATCCACAAACACCAA
GACGCCAGTCCGTCCGTCGGCATCGGGTGGAAGCCCGAAGATGAAGTCCATCGACACTGAGCGCCACGCCTCAGTTGCAATCGGCAGGGGTCGCAGGGGA
GCCTGCGACGACTTTGACCCACTTGCGCACCCATTTGTACATGTGGGGCCAGTAGAAGTCGCGGGATACTGCCGCGAACGTCTTTTCGCGGCCCAAGTGA
CCACCGACAGGGCTGTCGTGGAACTCGTGGATGATCCGAGCGCGCAGATCATCGTCGTTCGGGATGGCGATGCGGGGAGCATCGAATCGATCGATGCTGT
ACGTCAGCAGATCGCCGTCGAGTTGATATCGGTTAATCTGATTGCGCGTGTTATTCGGCAGCGCGCGGAGTGTTTTATCACTGGGGGAAAGAAGATGTGC
GAGGATGGCGGCATATACCGCGTCGTCGTTGTACGCAACGGCGATTTCTTCGCGTAGCGACATTTCTGGGGTCACGTTCATCAGGTTGACACCTGATGTC
AAGCACATCGCGCAGTGATCTTCGTCATCCTCGTCTTCGTCAATCACTTGACGACCCCGCGTCGCTCGTGGATCATAGTCTGGACGCCGAGACAGAGCAT
CGGCGAGGATATTGTTCTTGCCGGGCTTGTAGTGCACGACGAAGTTGTACTCAGCGAAGAACGACAGCTATCGTGCCATGCGTTGAGACAGATGTGGAGA
CTTCATCGCTGTGCGCAGCGATGCGTGATCCGTGTACACCGCGAACGTCTGTTCTCCGAGCAGGTACACTCTGAATTTGATCAGAGCGTATCGCATCGCA
AGAAGTTCCTTGTCGTGGACGGGATAGTTGCGTTCGGCCGGCTTCATCTGTCGTGATTGATAGCTCACGACTCGTTCGCGGCCTTCGTTGTCAAACTGCA
TGAGCGCGCACCCGATAGCAAAGTCGCTAGCGTCGCAGACGACGTGAAACGGTTTCGCGTCATCTGGGAGCATCAGTATTGGCGCCGAGGCCAAGCTCTT
CTTCACCGAGTCGAAGGCTACTTGATGCTCGGGGCGCCACGACCACGTGGCGTCTTTCTTCAACAGCGACGACAGTGGCTGTATCAAGCCAGCATATCCC
TTCGTATACTTGTGCAAGTAGTTAGCGAGGCCCAACCACTGACGCAGCTCAGTGGGGTTTGATGGTGGTGGCCACGAGCAAATAGACGACACTTTTTCCG
GGTCAGCACGGACTCCGTTTTTGCTTACGTAGCACCCAAGCACCGGAATTTCCGGCGCGCAGAAGACACACTTCTTGAGATTCGCGTAGAGCTTGTTCTC
TCTCATCACTTGAAAGACCTGCCTCAAGTGCCGCAGATGCACGTCGATCGCGCTGAGACCCTCTTCAGCGTGACTGTGCACAAAAATGTCATCGAAGTAA
CTCGGAGCGAAGTCACGAAGCGGGCGTAGCACATGGGACACCATGCGATTAAATGTGGCTGGTGCGTTCTTCAGACCTTGGGGCATCACGAGCCACTCCC
AGAGCATACCGCTGGGCGTACTGACTGCCGTGAGAGGTACATCGCTCTCTCTCATGAGGATCTGATAGAAGCCATCGGTCAAGTCGATGGCACTGTAAAT
GACGCTGCCCGACATGGAGTCCAGTACCATGTCCTTCCGCGGGATCGGTGTCTGCGCCGGGATGGTGGCATCGTTCAACTTGTTAAAGGCGTGTACGATG
CGCCACCCGCCAGTAGCCTTCTTCACACAGAAGGTCGGGCTCGAGTGAGGCGAGATGCTCTCACGGACGTGACCGGCTTGGCGGCGGCCTTCGAAGAAGT
CGTCGATGGCCTTGACTTGATCGCGCGGCAGTGACCACTGCCGCGTCACGCAGTACTTCGATCCAGGCACGAGGTCAATCTCGTGGCGCACTCCGCGATC
CGCTGGCAGCTCCGCAGGGATCTTGTCTGGGAAGACGTCGGCGAACTCGCGAGCTGTCTCGTAGACCGGATTGCCGGACGCCTTCAGCGATTCCCACGAC
TGCGCAGCGAAGCGCTCCTCGCGCGCTGACTTTGGTTCAGCGCTTTTCGGGCGCGACGACGTGTCATCATGGGCAATTGCGTTCGTCTCGTCAGACACTG
GGTTGGCATCGGTGATCAGGCACACTTGCTCGATGTCACCAGCCTTGAGATCCCTGAGGAAGCTCTTCCAGGAGAGACCTGGCAGGTCCGTGATGGACTT
GGCGTCGCGAGGTGGACTCGCGACCTTGATCATTCGAGCGTGGTTGAGAACACCTCCCACATATTCGACTGCACAGACCGACTCGATTGGTGGCGTCGTG
AGTTCCACTGGACTGCGGCGCGGCTTCAAACGTCTCCGCGACCGTCGGGATGTCTTCGTGCGTCTCGAGCCCCTGCTCAATACCGATGTTTCGCTGTCGC
CGGACGATACTTCACCCTCCTCTAGGCGCGAGAGGCCATGCTCGACCGCGCCGCTCATACGCGGGAGCAGCTCCTGCTCGACCGCGGTATCGTCATACGG
GAGCCCCTGCTCGACCGCCTCGAAGTCATGCGGGAGCCCCTGCTCGACCGCCTCAAAGTCATACGGGAGCCCCTGCTCGACCGTCTCGAAATCATACGGG
AGCCCCTGCTCGACCGCTTGATCATGCGGGAGCCCCTGCTCGACCGTCTTGGTGGCATGCGGGAGCCCCTGCTCGACCGCCTCGTTGGCATGCGGGAGCC
CCTGCTCGACCGCTTCATCATCATACGGGAGCCCCTGCTCGACCGTCCCGTAAACACGCGGGAGCCCCTGCTAGACCGTCGGGCTTGTCGCTGGGAGCGC
CGTGCGCTCCGCCGCCTTGTTCCTCGTCCGCGGGAGCCGCGGATGCTCAACCGCTCGCCTCGCGCGCCCGTAACCGGACGGGTGTTCGACGCTGTCGTCA
TCAGTCAGCAGTACTGCGCAAGTCGTGCAGAGAGGGCCATCGCTCGCTCTGCGCACAACGTGCGTCGTGGACGTCCCGTCCACGACTGTGACATGGGGCC
AGTCTCTTGGTGCCACCAAGAGGTGCGTGAAGACTTCGCTCACATCGAAGTCGCGTCGCCGTTTGACTGACCGGGCTAACCAGTCGATCTGGGGCTGATA
CCGGGACAGCCATGGTATACCCAGGATACAGTCAAACGCGTAGTTCATCTCAAGCACAATGAAGTTGTCATTGCTGCGGAAGCCGTCGAACGTATACGGC
AACGAGACTTCTCGTCGCGCGACACGGAACGGCTTTCCATCCGCAAGCTTGACAACGACATCACCAGGCACATCACACACGGGAACACCCGCGGGTAGGA
TCGACAGGCATGAAGCGCGGAAGAAATTGTTCGTCGCTCCTGAATCCAGGAGCGCGCGGAGTGGTCGTCGGGCACCGGCGACATAAAGGCTGACAATAAT
CAGCCTCGAGTCGCCACTAGCAGTGGTGGCATTAAAGTGTGCATAGAGCACAGGGGGGCTAGGAGGTCGGGCTGCCGCCGGGGGACCCGGACCTCCGTTC
CAGCCAGTAGGTCGCCCCGCACCTACTGGCCCCGGCCGTTTTTTGGCTGTGCGGCCGGAATCCTCTCGTCGGGCGTGACGTGCTTCATGTGGGCGAGGAT
CGGAGCTGGCACGCGGCACACCGCCGCGCGATGACCAGGCTTTCCGCAGCGGAAACAATTCAGCGAGAGGTCATTCTGACCACCGCGGCCTCTCCCAGAG
GACGACCACCGTCGGTTCTGCGAAGAATCGATCGCATCGATCTCCATTGGCTCGGGTACCGACACCCGAGTCTGCGCAGGCATCGTCTTGGCGTATGACG
ACGTCACCAGGTAGTCCTCGCGTAGCGCGAGAGCGAAGGCTTCTTCCAACGTGGCAGGCTCGGCGCGCGTGAGACAGTACCGCGTCATACCTTCACACAT
ACCAAACACAAAGACATGGACTTGGGAAGCCATGTCGATCGGCTTCGTGACGATACACGATGCAAGGTGTCGCGTTCTCTGGACGTAGTCGCGCATGGCC
ATCTTGCCTTGCTTTAGGGCGAAGAATGTAGCTCGAACGCGCGACTCATCCTGCGGTGGTTCGAAGGCGAGACGCAGGTCGCTCTGGAGTGCCTCCAGAG
TCGGGAACGCGTACTGGTCGACGACAAGTTTGCCGAGAGCCCATTCTTTGGCCTTTCCGGATAAACGGGATAGCAGGAAGTTCACCTTGGCTGATGGCGC
CTCGATTAGCCTCGAGGCGATCGCGATGTCGATCTCTCTGAACCAGCGATTCAGAGGTAGGCGATCAGGACCCTCGCCAGAATAGGAGGATGTCTCCATC
TTGACGGCATTGTTCCTGGACGCATGCGAGGGAGTTGATACTCGCCGTTTTGCTTCGGCGAGCTCGCGGTCCATGAACTCTTGGATGGCTTGGCGCTGTT
GGTCGGGGGTCGCTGAGCTCAGCAGCGACGTGACGACGGTTTCTCCGGACACCGCCGCGAGGCGGTGCAACGCTTGCCACTCGATAGACGTGAGATGGGG
GAAGGCCGCGTGTTCCAGGGTCATCACTGGAGGTCCGGCGGGCTGGTCTTCACTCATCTCGAACTTGGTCATGGGAAGGACTACGAAGTGCTACCAGGTG
TAACGGGCCAGGTGAGTGCCCGTCACTAGCTTACACGTAGCGGTGAGGAAGCGT