Description :
From Genome Similarity Track
Location :
Scaffold_204:1381- 6176
Transcript NameFunction/comments
Physo_144585reverse transcriptase
Physo_144586hypothetical protein

Sequence
4795 bases(100 bases per row)
GACAAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTACCGGGTGCACGACGGGTTTTACTCTACAGTGCAGTTGACGACAACGC
GGACCGCGTTGTCGTGCCCAATGACCATGACCTTCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTGCGGGGTATCCGGACCGTGAGAAGACA
TATCTTCTTCTCACGCGGGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGAGTGAAGCCTGCGC
CTTTCGCGCAGGCTCATTTGCATCACTGCCGACTCCGTCGGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGAACAGCCAGGGG
AACACGGGCGTTGTGGTCTTTGTTGACCGCTTTAGCAAGATGGTACATCTTGCGGCGGTACCCGCTGAAGTGACTGCGAAGCAGACGGCGCGTCTGTTCG
TTGACATGGTGTTCAAACACCATGACATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACCCTTCT
TGGGAGTCAACTTTCGATGTCGGCTGCGGACCATCCGCAGACGGACGAGCAGGGCAGACCGAGCGCGTGAACCGCGTACTCGTAGACGTGCTTAAGAGCT
ACGCTCACTGGAGCGAGTGCCTGCCGATGGCAGCGTTCGCCATCAACAACTCGGTACATGTCTCGATCGAGCATACACCGTTTTGCGTGAATGCCATCAG
GCACCCACGCCCCCCCGAGTCTACGCGGGATGGTGGCTCCTTCCTTAAATGGGGGGGGGGATCTCCGACTGCAACGCAGCAGCCGAAGACTGCCGCTGAC
ACTTGCACAGTGTCAGTCGCGACCACGCGCAAGAAGAACAAGAAACACGGATCTGTGCAGGGCACAGACACCGCCAACATGGACGCAGTGGCCGGGCCTA
CTGCTGGCAACGAGCTGAACTTGTTCAGCTCGGACGCAATCAACTTCGTGCAGCGCAGACAAACCGTCGTTCGGTTTTTCCAAGACGCTATTGCAGCTTC
TGTCGGTCGACAGAAGCTGAACGCAGACAACGTTGGCAGGGGTAACACAGATGAATTCAAGAAGGGTTCATTGGTTTTGTTAGCTACTCAAAACCTGCCT
AAACATGCCGTTTACAACTTCGGGGCAAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACTGTGCTGCCACGGCACGGCAACGCCTACACACTGGACA
TACCGTCTCGTATGCGCCTCCATTCGACGTTTTACGTCAGACGGCTGAAGCCATACGGTATGGCTCCAGAGGTTAAGATAACGCAAAGTATTGTATTACT
CAGTAATACAATTTCGGTATTAATACAGATTGTATTAATACTTATACTCGCTTTTTGGGCGAATGTATAAGGATAATTGAAGTAATACTACTCCTCGGAA
TTGGTAATACCAGTAATATTTTACGGTTATACTTCCAGAAGCCCATCCGAACCCACGCAGGCGCTATTTCAGTGCATGCTCGCGCATTTCCACTCTCTAT
ACGCCCTCCGCGGGGCTATTCGATACCCATCGTACCACGGGACCAACGCGAGTGCCCGTGCCAACGTCTACCACGACCTTAACAGAAACTTCTATCTAAA
TGCAAAGGGGAATTTTGCGTTCGATCACTAAACCAAGCTACCGTCATACTTCCCAACTACCCACAAAAATATTTCCCTGGCTGTGTTATATAAGACCAGT
GCCGCGGGACTACCACTTCATAGCCACATCTTTAGGTCGCGCTACCCTTGTCTTGGCTGCCTCTGTAACATAAGGACCGTCGTATGAATACTATGAAGTA
GGTCTTCAATGTCATTCGGATCGTCGAGGTGATAGGAACGCTTCAGCGTTGAACTGTTCTTTGGGCTCAGTATAGACTCGCCACTGGCGAAGCCGAGCTA
ATGTGGGCCACATAAATTTGTGCTAGCATGAAGTATTACCCAAATTATTAATACAATATGTATTAATACTGATACTTGTTTTCTATACGAAAGTATTGTA
TAACCGATATTTATACCAGACCTCCAGTAGGGTCAGTAATACTAATACCAAGATTTGGTCGATTATCTTAACCTCTAGCCATACCTGCAGCACGAGCTAC
TTAGCTCGGCTGAACCGAAGCAGAAGACTCGGCGGAAGCCGTCATCCTCTCCAGCGCGCAGCGCTCTGGAACTACTCCACGACCAGAACTGGAGACGCGA
GATCAGGGTCAACACCAAGTTGACCACACACGGGGCGTGTTTCCACCACTACCGCCGCCATTCGTGACGCACACGGCTCAACTCGATGGATAGTTGAGCG
GATTGTTGGTCACAGTATCCCGAGAACGAACAGGCAACCGGTTCGTTTTCGTATCCGTTGGAGAGGATTCCCTCCCAACCAAGATACATGGGAACGTCTT
GCTCGAAGGCGTCCCGGACATGGTGAGGGCGTACAAAGCCCACCATGCGCTACACGCTGAAAAGTAATACGAGCGCTGTTGTTAACAACAGCACCCGAAT
GCACTTCAAGGGCAGGCTGTGGGTCCCGCCCCCGTGGCAGCGACGCGCTTCGCACGTTGCCGCGCATTATACGCCGCAGCAGAGATGTCCTCCGCTGCTG
CGTCAGGGGTCTTCAACTTCGACGTGCTCGTTAAGGAGCGTTCTAAACTACAAGTCTGCCAACGGCTGGTTGGCAGGATTCCGCGAACATGCAAGTCGCT
CATTGGCTAAAAGATGCTGCTTTCAGCCAATTGGAATCGTAAATGTGTATGAACCACGCGTCGTGGTGGTCCCAAATGTATGCAGCCATTGGTGTACCTT
ACACCAAGGTCGAGAAAGTCTTTCGAACCTCTAACAGATGTCGTGTCTGTTAGAGTTACAAGTGGCTGTAGCCACTTGTGCGTGTAACGCCGTTACACCA
TCCCCCCGTCAAGGTTAGACGTGCCGGTCTCGGCAGGTCGACCACCATTGACCGTTTGGTCAATGCGTGACGTTTGAAGAGAGCGTGCTCGTTACAATTA
GGGGAAGTCAAAGCATAAATTACAAATAACAGTTCTCATCTTTTACCAAAACCCGCTACTAGTCTTTATATTCTTTAAAGTTGTGGATCTCGAGTATACT
TAACTCAAGTAAAAGAAACCTACGCTTCCTCATCCTCGTGCGCATACGTGTAAGCCGTAGTAGTGAGCCAAGGTAGGCCCATTACACGGATGGGGCGATC
CCAACTGGGAGTGTTGATCCCAATTGGAGATTCCCAGACGGAGACCCGAACTGCCTGGATGTGAATGTGTGAACTACGGAAAATTGATTGTGAGTTTGTA
TGGAGTGGGCCTACGACGGAGAGTAAGCTGAACGAGATTGGAGTTTCTGATGACGAGTGTATGAAGTTGACTATGCTGCCCTGAAGGAGGAGCCAAAGCC
ATAAGAGAGGAACAAGACTGCGCCCAAGGTCGAACTGACCTGGGTAATCTGACCGAAGAAGGAAACGATGAAGACAGCAAAGACATTAACGGTGGTGGTG
GAATTAGAGTGCTACGCTACGGGTATGCAACTACATCCAGGACTGCCGTGGATGCTGGATGGGGATGGCTTCACTGGAACTTGGTCGAGACCCAGTTGCT
GACGCGCTCATGTTCCTTGAGCAGCAGCTTGTCGAGGATCTTGGCCGGGGCATGTGGCAGACGCTCGTCCTCCGTACAGGTTGTCCACTGAGTTCGGCCG
GGGTCTTCATGTTCAGACATCGCGATCTGGTCGGCCAGAGTGTAGCGCGTGCCATCTTCTTTCTTGGTTGACTCGTCGACCAGGTACAGGTAACAGATCT
TACACGGTACAACCAGAACCCAGGCTCCGGACCATGGTCTTGGGCATACCGGCCTTGATCAGACGCTTGATGCGGGCCCCGAAGGTGCGCGCAACCCCGT
CGTGGAACGCTTGGCGTTTCCGGTGAAGGTCCTGAGCCCGTTCGTAGATCGTGAGGTCGTCACAGTTCTCGTCATCTTCGGGTTTAGTCTTCATCATGAA
CCAGTGCAGGATGTGCCAGAAGGCCGGAAGGTGGTCCTTCATGTACTAGACGTGCTGATCCAGTATGCGGATCACGGTCCAGGATAGCTGACCCCGGCGA
TGGAAATACAGGACCTTGACCCGGTTGTTGAACATCTCCAGCCAGGGTTCCGTCTCGACCAAGGCCGCGTACTCATCTTCGACTGCTGGCCAACGTCTAG
CCAGGAACTTGGTTTCGGGCTGATGGAGTGCGTAATTCGGGAAACGGGGTGTCTGACCCTCAATACCACATTTCTTCGGATAGAACTGAGTACCAACACC
ACGACGGCGCCACGAAACGATATCTCGAGATGATCGCCAACTCTTCGGCAGTCAGTTTTTCGTAAGACTTCTAAACCAAGGCTGATTTGCCGCCCTCTCG
CTGGGACTTCGACGTCCGACTGCGCTTCTTGGATTTCTTCCTGGAAGAAGGCGATCGGGTTTGTCCTGCAGCGGGAACTTGGACCGGGTAGACTGGGGTT
CTGTGTGAGACGACTGCCGGGGAGATGGACGCTTGGACGAAGAAGCCTGTTGGGGTTCGTCCTCGGACGAGCTATTGGACGAAGATTCAACGCGGTTCCG
CTTGGGCTTGCGCTTGGTCGGCTGCTCCTAATCGGTGTCGCTATCTGACGAGCTGCTTTCTTCGATGGATTCCGCCTTGCATAGCCCATCCGCGC