Description :
From Genome Similarity Track
Location :
Scaffold_188:1381- 3846
Transcript NameFunction/comments
Phypl_g4935hypothetical protein

Sequence
2465 bases(100 bases per row)
TCGTATTCGTTCGCCACATCTGGAATGTCGCGAAGGAGGTTGGCGCGCAGTTCCCACGTATCGTCTTCTGGCGGGAAGCCGAGCCATCGCACTCGATAGC
GTCGCGCGGCTGGAACCGCGCGTATTCGTCAATAATGCTTACGAGTGGCACGAGGTGGGTCCTCGTGCTCCACGATATGATCCACGATCCAGCGAATATC
GCCAGTCGCTTCTacaagcggcggcggaccATCACGTTTGTAGTACTCGCGTCCTGGACGCCCAGGACGATGTGGACGTGATGGTGGCTCAAACGCTCGA
CGATCGGTCTCACGCTAACGCGGCTCTGGATCATGTGAGGGCACTGGAGCGAGGAGTCTTCGGTCGGTTGCAGGATCGTACGTGGGAGCCGAGTTCGGAC
CGCTCGCCTCACGTGGTACTACTGCATCAGGCTGCAGTGGCGGCTCAGGAATCGTAGCTGAATGGTACTTCTTGAGCCGCCCGACGTAGAACGTTGGGAG
TAGTCGCAGTGACGTGGGGATGTCTAGGGTGTAAGAGTCTCCAATTACCTTTGTCACCTCGAACGGGCCAACAAAGCGCGGCGCGATTTTTTTCGCGCCG
AGGTTCGTCACCGCTGAGTTCCGTATGTCATCTGTCGACTGGAGCACTCGCTCTCCTGTCCTGAAAGAAACCATGTTCTTCCTTCCGCGATGGTCTGCGT
TCTCCTTTTGCTGGTCCACAGCTGTCTGCAGCGAATTACGGACAAATCGGGTGACCGATTGGCGCTGAAGGATGAACTCAGCCACTACCGCGCTGTCGAT
GGGTCGCGCCGGAGGCTTCGGCTCGTAGTTGGCAATGGGAAACACGTGGCTGGGCGGCGGAGCACCCGCAGTCGGTTTGACCAACGTCCGCGTAGTCCAC
TTGGCGACAGGAGACGCCACGTCACTTGGCGTCACGACAGGCATCTTCACTTGGGATCGTGTGACCGCGTTAGTGCTCAAGTCGCCGTGAGATGCACTCG
TTGGTTGTAGCGGTACGTCTTGCAACACCGGTTCAGAAACCGGTGTGTCTCCAGTCACCGGAACAGTCGCTTCAACACTTCCTTCCCCACCCAGAGTGGA
GTCACAATGGCccatggcgagcagcgctggcacgcgttgttcacgaagaaggcaTCAGATCCGTTGACGCGTGTTCCGCGTTGTTCAGCGCGAACTCGGC
AAGAGGCAGGAACGAGCCCCAGCACGAGAAAGACGTCGCGTAAATTTGAAGTACGTCTTCGAGGACCCGATTCACACGCTCGGTTTGCCCACCCGTCTCT
GGATGTGCCGCGGTTGACATCAGGAGCTTCGTCCCCAAAAGCTCGAAGATCTTTGACCAGAAAGACGAAGTGAAGCGAGGATCACGATCCGAGACGATGG
ATTCGGGCAGGCCATGGTGATGGAACACTGCGTCGACGAAATGCACCGCGGTTGTCAgccgaggtggccaagtCAGTCACCAGAATGAGATGGACCATCT
TGCTGAATCTATCGACGAAGTCCAAGACACCAGTCTGGCCCTGCGCAGCGGGTGAGAGCCCGAATATGATGTCCGTCAACACCGAGCGCCACACCTCGGT
TGCTACAGGAAGAGGTCGCAGGgggccatcgacgacggagaaggcTTCACGTGCTAACAGGTCTCACAGGTGCGGACCCAGTTCCGCACCCAATTGTACA
TGTGAGGCCAGCAGAAGTCGCGCGACACCGCCGCGAAAGTCTTTgcgcggcgccagcgaggGCATTGTGGAACTCGTGGATGATTCGAGCTCCCAAGTCG
GTGTCATTTGGAATTACCACCTGAGGTGCATCGAAGCGATCGATGCTGTACGTCGGTAGATCTCCATCAAGGCGGTATTGGTCGATCTGGCCGCGCTTGG
TGCGCGAGAGAGCTCCCAGTACAGCGTCGCTGGGAGCGCGCAAGTACGCGGCGATGTCGCTGTACACGGAGTCGTACTCGTACGCTGCTGCAATCTCGGC
GTGCAGCGGCATCTCGGGACTGACACTCGTCAGGTTCAACACTGAGGCGATGCATATCGCGCAGTCgacttcgtcatcgtcgtcgtcaacaGTCTGACGA
CCCAGCACCGCACAAGGATCGTAATCCGGGTGCTGCAACAAAGCGTCGGCGAGAATGTTGTTCTTGCCCGGCTTGTAGTGGACGATGAAGTTGTactcgg
agaagaaggagagcCACCGTGCCATGCGTTGCAACAAGTGTGggctcttcatcgctgtGCGCAGCGATGCGTGATCGGTGTACACGCCAAATGTCTGCTC
GNATGCACTCTGAACTTGATCAGAGCGTAGCGCATCGCAAGGAGTTCCTTGTCGTGGGCCAGGTAGTTACGCTCTGCGGGCTTAAGCTGTCGAGACTGGT
AGCCCATGACCCGTTCGCgaccctcgtcgtcgaactgcaTGAGCGCGCAGCCGATTGCGAAGTCG