Description :
From Genome Similarity Track
Location :
Scaffold_1:1380755- 1407159
Transcript NameFunction/comments
Phyin_T30-4PITG_00219Glucan 1%2C3-beta-glucosidase%2C putative
Phyin_T30-4PITG_00220General transcription factor IIH subunit%2C putative
Phyin_T30-4PITG_00221Tryptophan synthase%2C putative
Phyin_T30-4PITG_00222Putative uncharacterized protein
Phyin_T30-4PITG_00223DNA repair and recombination protein RAD54
Phyin_T30-4PITG_00224Putative uncharacterized protein
Phyin_T30-4PITG_00225Sialin-like protein
Phyin_T30-4PITG_00226Kinesin-like protein
Phyin_T30-4PITG_00227DEAD/DEAH box RNA helicase%2C putative
Phyin_T30-4PITG_00228Amino Acid-Polyamine-Organocation (APC) Family
Phyin_T30-4PITG_0022926S protease regulatory subunit S10B
Phyin_T30-4PITG_00230Peptidyl-prolyl cis-trans isomerase%2C mitochondrial

Sequence
26404 bases(100 bases per row)
CAAAAGACGATAACTCAGGGCGCTTCAATTGGCGAAAAAGGTGTTGCTGCGAATCATGTGACGTTGAGAGTCAGCTGACTCTCTCTCGCCATTCACCGAT
TTGCTTCGACGACGACGGAGGCCACTCGGTACAACTCAGGCTTCTCATCCCCTTCGATCTTAGACAAGATGGTTCGCGTGCTCGCCCTCTCCGCTGCTGC
TGTTGCCGCCCTGGCGTCCTCGACGTCGGCGCTGGACCAGAAGCTCTACGGTCTCAACTACGACCTGCGTCAAGGCCCTGACTGGGATCCCAGCAAGTGC
AAGTCCGCGGACACCATCGCTGCTGACCTCAAAATCCTTAGCACCATCACATCTAATGTGCGTACCTACAGTCTCTCGGACTGCGATGTCACGGGCGTGC
TCAAGGCTGCCAAGGACTTGTCGCTCACTGTATGGCTCGGCGTCTGGGTGTCCGAGGACGAGAAGGTGTACGACGCCGAAGTCAAGGCCTTCAAGGAGCT
CATCAGCGCCGGCCTCATTGACAGCAACGTCGTGGGAATAAACGTCGGCAGTGAGGCTGTGTACCGCGAGGACATCTCGGCTCAACAGGCAATCAAGTAC
GTGACCGACTTCAAGAAGGTCATGTCGGACAACGACATCAGCGTGCCCGTCAGTATCACGGACATCATCGACACGTTCGTGCAGTACCCGGACATGCTCA
AGGCCGGCGACATCGTGACTATCAACCAGTTCCCCTTCTGGGAGAAGATCGAGGCGGACAAGGCTGCCGCTCAGTTCAACAAGCGTATTCAGCCTCTGCT
CAAGATGGCTGGCGACATGGAAGTCATTATCAGTGAGACCGGTTGGCCCACGGGTGGCTCAGCCAAGAACGGATCGGTAGCCTCGGAGGAGAACGGCGCC
GTCTTCTTGAACGACTTCTATCAGTTGGCGGAGTCGAAGGGGTGGAAGTACTACTACTTCGCGGGTTTCGACACGCCCTACAAGGAGGAGCAGGCGGATG
ATGCGACCACAGTGGAGTCGCACTTCGGTATCTTCGACGACAAGGGAACCATGAAGCCGGCGTACGAGAACCTCAAATTCACCAAGAACGACGATTTGGG
AACGTCGGGCAGCTCCGATACGACCACTTCGTCGGGATCGACGAGCACGTCGGTAGGTGCGGGCACGGTCGCCCCTGGTGATGGCACCTCGCCGGGAACC
TCGGGCACGTCCACGACGCCTGGCACTTCCAACACCCACTCTTCCTCAAGCACTAACCCTTCCAGCATTTCGACTGAAAACGGATCGTCGCAGCTCGTTG
CTGCCAGCTTTGTTGCCGTCATTGGCGTCGTATCCACCATGTTCTGGAGCCTGTAAGCAGGTGTAACAAAATGAAAACGTGAATGTTACGGTATTTGTAT
TGTTTTTGTTTTGTCCGTAAAATTGTTTTTTTTTCAACGGCTTTTATGTAAGGGACATAAAGTCAATCCAGACGAGCATGGCGCAAGCGAATAGGGCGAT
CAGCACCGAGGCCAATGAAGGGCTGCTAGTCTTGGTGATCGACACCAACCCCGTGCACTGGTTCACGAATGGCGGTAGTGCGGCGGACCGCGCCGGGCTG
CAGCAGCTGATCTCCAGTACGCTCGTATTCGTCAACTCGTACCTGCTTCTACACCGCAGCAATCGCATTGTCATCATCGCGGCCCACGCCGGCAAGAGCG
CAATGCTGTACCCGGATCCAGAGCAGGACGACACCACTGGAAGTGCCGAACAGGCTGCCAAGGTCAATGCTGGTGTCCTGCAGCGTATGCAGCAGCTCAG
CGACGCCCCTTTGGACCCTGCCACGCCCAACCAAACTGCCATCGCTGCGTCGCTATCACGTTCACTATGCTGTAAGTTTCTGCAATGGCGTGAAGTGTGG
GGGAATTGATTTTGACACTGCTGTATTGCTATTCGGCTGTGACATGCAGTCATTAATCGTGCTATTAACGAGGAACCGGATTTACGACCACGGATCTTGG
TCATCCAGAAATCTCCGGACGTTTCGGAGCACTATATCGCCATCATGAACGGCATTTTTTCAGCTCAGAAGAAGAGTGTTGCAGTGGACGCCTGCATCCT
CGCGACGGAGCACTCGTCGTTCATGCAACAAGCTGCGTATCTTACAGGCGGCATCTACTACAAGCCAAACGATCATAGCGGACTATTGCAGTATCTGATC
TCCATCTATCTACCAGATCCGTCCATGCGCAAATTGTTGAAGTTGCCATCGCAGGACTCGGTGGACTTCCGTGCGATGTGCTTTTGTCACCGCGAGGTCA
TCTCTACGGCGTACGTCTGCCCGGTGTGTCTGTCGCTATTTTGCGAGTTCCGACCCATCTGCTCAACTTGCGGTATTCGTAGTCACATCCAGCCTAAAAA
GAATGGTTTGCACAAGAAGCGTCTACGGGTGGATTAATACACGCAACAGGAGCTTGGACAGCTGCTGTTGCACTGCAATTTCTGTTGCATCTGATTGGTT
TGGATAAATTTCGATGGCAAAATCAAGATTATGCGCAAAATATTGAATATTGATTGGTTAAAACCTGGTCTTGGCATCCTTATGACCAATTACAGTTATT
GAGTGCTTTAAGCGGGGCAGACGTCCACTACGTCACACTCAGAATCTCCACACAAGCAACAGACCGACACAATGAGCAGGTGCGAGTGGCATCCCAGCAA
CTTCGTGCAAATTTAGCCTTGTTATATTAATTGTATAACGTGGCATGTTGCAGACCGACGATCTCAGAGGTTATCGCCGAGCGGAAGGCCAACAACACTG
CGGCTTTCATCACCTTCGTGCCCTGCGGCTTCAAGACTAAGGCTGACACAGTGGACATTCTTCTGGGACTGCAGCGCGGCGGCGCGAACATCATAGAGGT
GGGCATTCCGTACTCGGACCCACAGGCCGATGGCCCGACCATCCAGCGCGCACACCAGGTGGGCGTGGACCAGGGCATCACGCTGCATGACGTCCTGGCC
ACAGTGAGCGAGGCGCGAACTAAGGGCCTTACTACGCCTGTGGTGCTTATGGGCTACTACAACAACATTTTGCAGTACGGCGAAGTCAAAATCTGCCCCG
ACGCCCAGAAAGGTACGCCTGTAATCGACCACAGGAGAGATTTGTGGGCTCAAAAACTGACAATAAACGTATTTGTAGCTGGGGTGGACGGATTCATTAT
TGTGGACCTGCCGCCTGAGGAGGCAAAGACGCTCAGTGACGACGCAGCTAAGCACGGACTTGCGTACATCCCGTTGGTGTCCCCAACGACGACGGAGGAG
CGTATGAAGCTCATCGACTCGGTGGCACATGGTTTTGTGTATTGCGTGAGTCTCACCGGTGTCACGGGCGCTCGTAACGAGCTGCCTCCGAACCTCGACG
CGTTCATGGCCAAGAGTAAGTTGCTTTTCGCGCTTTAGTTTATTTTAATTGTCGAGCTAACGTGGTCCCTTGATTCGCTGCAGTTCGTGCCAACGTGAAG
CACCCTCTCGCTCTTGGCTTCGGTCTGTCGACCCGCCAGCACTTCGTTCAAGCCAGCGCGCTTGCGGACGGCGTTGTGATCGGCTCGAAGATTGTCAAGA
TCATCGAGGACGCGCCTGACACAGCCACGCGTGCTGCCAATGTGGAGGCATTTGCCAAGAGCATCGTGAACCCTTAGACAATTAGAGACGGACAACCCGG
GCACTGTGCTACTACCGTGCCCGTTCCAATATACTGAAAGGTAATACGTAGTATGTAGCAAGCTTAATAATGATGTAATGTCATGCAGTGAGGTAAATTT
TGATGCTGCCAGTGGCTCATATGGCTACAGTGGCACATCATTGCTTTAGACGTTCGTTGGCGTGGGTTCGAGTCCCTCAGTCGGCGAAAAGAGCAGTCCC
ATTCGTACTTAGGATTTGTAAATTCAATTTGTAGCATACTTCGAAGCCCGATGTGTCTGTACAATTAGACTAAGGATCGGGTCAAAATGTGTGCAATAGT
GGCAAAGCGTGTCAGGGTGTCAGTACTGGGTGATTGGCTAAAAGCTCAATTAGTCTCAGAAACTGCCAATCGACATGCGCACATTCTTTTGATTGATAAG
ATCGTTGAACGCGAAAGGGTGCAACTCGCTTCAACTCGGACGATGGAGGCGATGAAAAATGAGGGCAACGCACTCTTTCAGCAGCAGCGCTTTGCGGAGG
CTGTGCATGTCTATACTTCCGTCCTTAACAAGCTACAGGAATCCGGCACTATTGATGAGCGACTTGAAACTGCAGTGCGACTGAACCGCGCGTGGGCCCG
GATCCAAATGCCTAACGGTGAGAGCGGCGAGGCCACGCTGGCTGAGGCAGAACAAGACTGCAGTAGAGTGATTGCAAAGGATGCATCATGTGTGAAAGCG
TTCTATCGACGAGCCTTGGCACGAGAGCGCAGAGGACTGTGGAAGGTACGCTTGAATTAAACACATCAGTTAAAGATTCTTATCGATGATTTTTTTTAGT
TAGCAATGGAGGATGCACTTGCTGTCAAACGTCTCGAACCTGGTAACCCTTCCATCGCTCCATTGCTGGAGAGGCTGCATCGGCACAGTCAGGAGGAAAA
TGACTTGACATCGAGGCTGCAACAAAGCACAATCAGTAGCGCCGCCCACACTAACTCTTCATCGAGAAATGCACTTGCTGTCGAGGCAGAAGATGCATGG
GAAGCGCTACAAGCTGCTGAAGTCAATCTTCGAATGGTCTATAAGTCTTCGAAAAAGTCCTCAATGGCGCGGCGCAAACCGAAGAGTTCTCAGATAAGCA
AAGGAGACATCTTGCAGAAGACGGATGATGTGTGGGAATCGCTGAGGCGGGAGGAGATAACGACAGTCGCTAAAGCTTTTCCTCGGTCGAAGAAGAAAGC
TCTTACTTGAGTAAAACTATTTCCAACATTGAGAAAGCGAGAGCCGAGACAATGACAAAAAATCTATTGCTTGTATGCTAACCCTACCAGTCTTCATCGT
CGTCGCCGCCCAGGTCAATAATTTGAGGTCGAGCTCGTCGGTAGCGATGACCGCAGCTTGAGCAGCTAGCGTTGGTCGGCGGATTGATCAACGTACATCG
TGAACAGCTCCAAGCAGCCGCAGGCTTGTTCTCTTCGTGAGTATCGTCCGAAGCTACGACTTGCTCACGATCTGATCGGCGGTGATCGCTTAAAACGTCC
TCGATGAAGGCATCCTCGTCGTCGGAATCAGAAAAGTCACTCATCTTTCGCTTCTTCGACGGTGACCAAGAGCCTTCATCAACCTCAGGAGCAAACGTCA
CACTCCGCTTCGTCTTGACGGGCACTGCTGCTGCTGTTTCAGAGTGGGTCGGAGCCGGATGAGAGGATTCCTCTAGCGAATTTGCCGCTGCAGGGCGTCG
GAGAGGTGGCTTTGGCGTACACGAAATGTCAACTTCAGAGACCTCGGAGCCAGGCCGAGGTCGCGACAAGAAATCGTCTTCGCTCTCCGATTCACTTTCG
CCCAGGACTTCGTCGTGTTCGTTTTCATCGCTGCTTGATCCTGCCTCTGATTCGTCTGACTCGTCGATACTTTTGCTTTTCTTCGTTTTGGAGCGTTTGC
TCTTGCTTTCTTCTTCAGCCCGTTGCTTTGCAGCCTCAATAATCTCCATACGCTTACGTTTCCGCTCTTCATCACGTTGGTTGTCCTTTTCTTCGTTTTC
AGCTTGATGTTCTTGGAGCAGCTCCCAGTCGATACGACAGCTGAAAGCAAAGCTTACAAGGTCATTCTGGACTTGCTGTAAGGCTGTTTGCATCACTTCG
TCATCGACAGAAGCGTAGGAGCGATGGTGACCCCAACTGTTCAAATCTTCTTCTGGTGGCATGCCGATTTGCGGATGATAGCCCTTGTCTATGTCCTGGT
CAACGTCCTCGTCACTGGTGATGTCTCTATCAGGTGAAATTTCGTTTCTTGCTTCATTTTCAGCAGCATCGATCGCTATTTCAGCTGACGTCTCGTTACT
AGTATTTCTCCATTGACAGCGATCACATTTCAGCTGATCGTGTGTGTCGGACATGGTGTCTTTCCGGAATACAAACAGCCTCTTGAGATCCTTAGAAGAC
AGCGAGTTCACTTCCTCCTTATCGTCCACGATGTTCTGAAGACCCTCTTTAGACAGCTGACGTTGGAAGATCTTCTCTTCGAGAGTTCCCGTCGCTAGAA
AGCGGTACACATAGCACATTTTCTTCTGTCCCTCACGCCACACTCGAGCAGCAGCTTGTTTATCTGTCGCGGGATTCCAATCAGGATCAAAAAGCACCAA
CCGATTCGCGCCAATTAAATTCAAGCCACATCCTCCAGCTTTACTTGACAACAAGAGCGCAAACGAGTTCGTGGTTGGTTCATTGAAAGTGTCGACCAGT
TTTTTCCGCTTCTTGGCTGACGTCGTTCCATCCAGACGGACAAACGGCAAATGCCGCTCCTGACAAAGTGTAGAAACCACATCCAGTGTCTGAGTGTAGT
TGGATACGATCACGATCCGATCTGTTGTTGTCTTCCTCATTGAGAACATTAAACGGTCAAGTAGAAGCATTTTTCCAGACCATTCAGGGTAGCATGTACG
TCCTCCGAAGCCTCCTCGTCGATGCCTGCTATCACCACCTCCACCTTCTTTCGATGATTTCGCTGCTGTAAAGTACTGAGCGCAATTGCTAAACCCAGGA
AGCTTCGTGTTGGTTTTCCCCATTTCATCAAAGATCAGCAGCGGATGGTTGCACAGCTTCTTCAACGCAGTGATAGAAGACAGAACATTCGCGCTGGAGC
GTTTCATCATATCGCGACAAGCACTGGACGACAGGAAATGGTTGTAGAGTTTGTCTTGAAGTGGAGATAGCGGACAACAAATCACCTGCATGAGCTTCGG
TGGAAGATGCTTGGCGTTTAAAATGTTACCTCGACGTAGAATAAACTGGTTGACGATCTCACACAGCATAGCCGAGCATGACTGCGCCACTTGTCGCTCC
CGATCCGTCGAATCTGGCTCGCGTCCAATGAGGATTGGCCCCAGGTAATTTTTCCGAAACTCGCTTGGCGTTCCAAGGATATTTGGGTTGGTGAAGTCTA
CCATGGCGAAGAATTCCTCCAGATCATTCTGCATCGGTGTACCGGATAGAAGCACACGCTTCCGACACGCCAAGGAAGACAGCGCCTTGTTAATCTGCGA
ATTGGCGTTCTTTAGTCGATGTGCTTCATCACAAATCAGCAGATCGCAACATGCTGGAGTGTCTGCGAACTTCTGAGCGTGCATACGGAACGTCTCGTAG
GAGATGATCAGCACTTGGGCTGAGAAACCAGGTCGTGGCCTCTTGCTTCCCTCGATAAACTGATTAATTCCCTTGATTACCGTCTCGCGCTTGGCTTCAA
ACAATGCCACCGTCTTCACACGTCCGTGTAGCCATTTGATAATCTCGTCGTCCCAATTCTTGACTAATGATGTCGGACACACTACGATTGCTCGATTTAC
GGTGGGCTTCATGTCCATCCCGGTCAGCAGCAACGTATACATCAACGTGATACTCTGTAGGGTCTTTCCGAGACCCATGTCATCAGCCAGGATACATCCT
TGACCATCAAAGCCCTTTACTTGACACACACAGTCAAACATGAACTGTACGCCTTCTCGTTGATGAGGACGCAGGAATTTGCCCACGATTTCAGGCACCA
CGACTTTAATATCGGGGTCTGTCTTACTCTGCCATAATACAAGTGGAGGTGGCGCATCGGCTACTGGAGCTGTAGCTGGAACAGGTTCTTCTACGGCTAT
AGGTTCGGGCTCGATGGGTGTTTCGATCTCCTCGACGTCCACTTCAACAGGCGGCATGTCATGACGCACCATTGGCTTTAGTACTAAAGAGCCCCAGCGT
CGACGCATTCCTAGCGTCTTGGTCTGAAGCAGGCGGTTGCTCTCCTGTGAGCGGCCACCTTCTCCGCATGGAGACTTGAATGGACGTCGCACGCGCTGTG
CGCGACGCTCGGGCTCCATCACAACGAAGGACAGGAACGGGAGCCGCTTGACAGACAGCGACGCGCCACTACGTAGCGCCTGACGGTTGTTGGCGGCATC
AGATTCTTCGTATGCGTCCTCGTCGTCGTCTTGAGGTTGGGCAGATGCTGGTTTGCCCTTCACGGGCAGTACGAACGGATTGAACTGGGCGCCGCCTCCG
CGTCGACGCAGCATGTTGCTGGACGAGTTCAAACTGCGGAAAATGCAAGCAATGATGACATTTGATTGGACAAATCGAAATAAAGACTATCACTCTTGTT
GACAGACCTATCTATGCTTCGATTGGATCAAATAGATGTTTACCGGTTAATTTGACTGAAGGTGCAGAATGGTCGCTGAGGCGAAGGTGATGGCGTTCCG
GCGCGGGATGTTGCGCTGGATACATAGCCCCACACTTGCTAGTGCAATTCGTGCTAGTAGTAGAGTCTCTTCTCTACCAGCTGAAGGTATTCATACTCGT
CAGCTCGCAGTATTGGCGTCAAATGATGAACAGGGAGATCATCAGCGTGCTCTCCTGGGACTTACCGAAGCTTCCAAGTTGTCTTGGAGATTGCGCGCCG
TCGTGAAGGATGTGGAGCAGTCGTTGCCATCCGAAAGAGGAAGACGGTTCTATAATCGTCGAGTGGTGGAATCCTTGGAGCAGGGCGACCTCAATCGCGC
CTGGGCCATCGTGGAGACGCTGCATCAACGACACCCAGACAGGGCCGTGCTTTGGCCGTACACGTACAACCTGCTGCTACGTCACTATTGCAGACAGCAG
AAGACTCTGATGAATGCGAATTTGACTCGCATTCTGGCGCTACTGGACGTAATGGTGGCTCATGGGTGCGCGGACCAAACTAGCTTCGAAGTGGCCATGG
CAGCGTGTAGTCGAGCCCGACATTTACGCAGTGCGAGACACGTATTGAATAAAATGGAAGAGAATGGACGAGAGCCTGACGCTAGGATCTACGGCTTTTC
GATCAACTGTTGCGCCAGGAAACAAGGGCTCGTAAGCACAGCGGAAGAATACTTCGACGAGATGTTGGCTACTGGAGTGAAACCGACGATTTTGGTGGTT
AATTCCTTATTAAGAGTGTACTCGCGAGGCGTTGGGCGATCAAAGGTGATGCTAGAGCTAGTGAAACGTGCTCGGGATGAGTTTGGCTTGGTTCCCAGTA
CTGTCACGACTCGGACGATGGTGTATTATCTACTCTGTGAAGGTGATGTGCATAACGCCGTGGAGTATCTCCGTAATGTTGAGAAAGAGTTTGCACCTGT
GGGAACGATAAAGCTGCCGGTGACGCGCCAAGTGTTAAACTCACTGGTTGATACTTGTCGCCAGCGAGGTGATTGGAGCTCAGCGGAGTACGTGCTTAGT
CTTGTGGCAAGGATTGATAAAGAAGATGCATTGGTTGTTGAGACTGAAAGAGATGCACAAAATACGATACAACTGGAGAAGTTGGTTGCCAACCGCGACT
GTAAATCCCCACCCATAGTCTGGGCTCTGGATGAACAAAACTGGACGCGGATGACACAGACACGCCAGGAAGATTTCTTTCGGAATCAAAGTCAGAAGCA
AAACCTCGAACGCGCTGAAGAACGAATGCATTTACGTGCTTCTTCGTCTAGAACCGACCGATCAATCCAAAAGCAGTCTCTGAAACTTGAAGGAAAGCTT
CGTCTTTTGGATGGAATAACTCGCACCGGAAACGCTAGTGCAAATGACTTCAATGCCGTGTTAGGTGCTTGCGGAAGACAGGGTCAATTGGCCCAAGCTG
TATCTGTCCTTTCGAAGATGAAAAAGTACGCCGAGTCTGTGCCAGAATGTGCGCCGACGACGTGGAGCTACAACGCGTTGCTGAATGCGTGCGCCGTTCG
AGGGGATACTCAAGAGATTGAGGCAATTGTGAACGAGATGCTTGACAACGATTTAAACCCTGACCAAGTCACCATGAATACGGTGATAAAGGCGCATATC
ACAAACTTGAAGAACGTGGTTGGTGGGACCTCCCAGACGCGTGTGGACACCGTGATGCAAGCGCTTTCATTCTTTGAATGGAGCACTGAGAATCAAAAAC
TCGAGTCAGGAGCAGCGACGTATTACTCGCTGTTTCGGTTGTTTGCTACGTATTTAGAGACTCCTAACGAGGGCAATACCAATCTTGCTGATGATGGAAT
TGATGATGACGTCGAGGAGAACGATGAAGACTTTATCATTGGCCAAGAGGGAGAACTAGTGGCTTGGATGTCCGAGTTTATCACCACCACCTGTCGGGAC
GCACCGCTATCATCACTGGATGTTGGAGTGTTTAACAATGCATTCGACTATTATCATCGACTTGGAGACGTGGACGAATCGTTTGCACTGTTTAACGTTA
TGAAAGAGCGCGGATTTCAGCCTGATGACGCGACTCTCGGCTTGATGTTTGCAACGTGTGCAGCCCAACAGCAATTCGACGTGGGCTTGAACTTCCTGGA
TCATTTAATGACCAACGACGGCTACAAACCCACGCTGAAGGTCCTCAGTGGAGCGATGCAGCTGTGTGCAAACTCAAAGAACCCGGACGGAGCGCTAGAA
CTCTTTCGAGCTATCGAGACGTCAGGTGCATTCACACCTACAGTGGAAACCTATGAACCCGTGGTCTTCGCGTACGCACGTGTCGGAAATGTAACCAGTG
CGTGGGAGATGGCAAACAAGATGGAAGAACAGCTCGGAAGAGTATCGATCAGCATCTACAACCGGATTTTGCTGGCGTGTGTGGAAGCCGCGCTCCCTGG
ACGTGCCCTGGAAGTTTTAGGGATAATCCGACACAAGGACGGAGTGACTCCTGACGTCATTTCTTACAACACTGCACTCGAAGCTTTTGTTCGAGCTGGA
GAGAGAGCTGCATGGTGGCGGAAAAACAACAATAACCAGGGAAAAGACAGTGATGCAGAGTTTGATGATGAACTCAGGAGTAACGAGGAAGCTGAACTGG
ACAGTGACGACTCGGATCAAACGCAAGCGACTCTATCCCAGGAAAATGAGACCCAGCAGCGTGAGAAGGCAGCGTGGGCTCGTGCTAGTGTGCTTGACCT
ACTGGAGGAGATGCAGCGACGTCGAGTGAAGCCCGATATGACAACATTTGAGCGTGCGATAGCTGTGTGCAGCGTGAATGAGGACTTTGAAGGTGTAGTC
ACTGTATTTGACAAACTGGTTGATCGCAAGCGGGGTAAAGATGCCATTAACCTGAGAAGTGACCTCGTGAGTGACTCAAGTTTGACCGCATACCTTGTAG
CATGCACGTCATTGCGAGACAGAGACCGCGTCGTTGAAGCCCCGATACTTCTCCACAAATGGCACACTGCTACTGGCCAAATTCCACCAGAATTTGTCGT
GACGCAGCTGTTGGACTCGCTGGAGGTTCTGGGCGAATGGCGCTGTGCTGTCCGGATGCTCCCTGATTGGCAAGCGCAGTTCGGGGTTTCACCTAGCGTT
CAAGTGTTCAATCGCGTGATGCAGATGTGCAATCACGCAGGAGAACACCAACTTGTGGCACCAATATTCGCTACAATGCAAGATGCCACAGCTTACCGTG
TCTACCCCGACGCAGAAAGCTACATACAACGCATTTCCGCCGAGGAACAACGTGAGAATTGGGTGGCAGCTACCGATCTGTTTGTCGAGATGCAAAAGCG
CTTTCCTAGCGAAGAGATCTCGCATCAGCAGCTTCAAAAACTCGCATTGGGACGGTATAGGTTGCGACAAAATGAACATTAGTGTTAGCGACTGGTATCA
CCTGTTTCCTCTTCACATTGGGTTCTCCAGCAGACTCTCCTCTTCGTCTCGAAGTTCGGGGATCGAAGTAGAAAGCGACAAGCCATAGTTGGGGCTACCA
GGGAAGCTGCTTGATGTGGTGCTGGTACTGCTGTATCCTTCTCCGTAACTGCTGCCAGACTGCGCGTAGATGGACTTATCCGAGGCGAAACAATGGAAAA
CCACAGCACCAAAGACGAGCACAAGTGCAGCGATGGCGAACACGAGGTCCCACGATCCAGAAGCATCGAGTATTGCGCCAGTGACCACATTTCCGATGAT
ACCGGGGATAGTTCCAAAGGTATTCGAGACCCCCATCACATGTGCAGCGTGGTTGGGCGCCACATCGATCATGTTGACCCAGTATCCAGCCATAGCAGCA
CGACTCGTGAACAGCGTTAGACACAGTAAGGCTACAGCCACGGGAGCAGACTTTGCGAGGCGTAGCGAGAAGAGGAAGAAGGCGCATCCGAGGAAAGAGA
ACGCGTTCATCATCTGGCGGACGTGCAGTTCACGGAACCCACGAGTGACCAATAGATCTCCCAGTCGGCCGAATAGAAGTGTGCCGGTGTAGCCGCACAT
GTAAGGAAGTGCAGCAGCAAACCCTCCTTTTTTGGCCAAGTCGAGGTTCAATACTTGGTTGAAGTATTGCGGGATCCAGCCCAGCAAAATGTACCAGCTG
TAGTTGTAGCACATGTGCGCAACGTAGATCGCCCACGCCGGTCGTGAGGTTAGTAGCACACGCCAGTTCATTGCGTGTGTGTCTAGTTCAGCACGCGAAC
TCTGACGACGATGAGTCTCTGGGTCGACTGTACGGTTACGGATGATGAAGTTGCGTTCCTCATTGGTGATGTGAGGGTCGTCTTCCGGTCGACTCACTCC
CATGATCACGTACGCGACGACCCAAATGAAGCTCAACACGCCGAAGACGACGAAAATACGTTGCCAGCCACTAGCTGCCATGATGGCGGGTGAGATCATC
AATGCGGAGATGGTGCCCAGATCCGAGCCACTTGCTACTAGTGACACCAGGCGACTTCGCTCCTGGACTGGATACCAGGCACCGGCAATTTGGTGCATAC
ACGGGAATAAAATACCCTCTCCGAGTCCCATACCTGCCCGTGTGAAGAACAGACACGTGAGGCATTTGGCCACCAGAACAGTCGACAAATCCTGCAACAA
CAGTGCAAGTGTCAGATATACTTTCAACGCTACATGTACCTCAGTTTTAACCAGTTACTACATACGAACAGTGTCCAGACGATCACTCCCGTCAAAAGCA
CAATCTTGGCACCAAATTTAGCAGCGAAATACCCTCCAGGGATCTACAACAGCACAGTCAATCAAGACGAATTCTTTGAGTTTGATGACTTGTGTAGGTG
TACCTGAGTGCACATATAGCCATAGAAGAAGGCGGACAGCACTTCGCCCTGCTCCTTCTTATTGGTCACAAATGCTGGCAACGCGATGCCCATGTTGGTG
CCTGCAACAACAGAATCAGATCCAGCGCTCACAAATAACACCCTTCTTACAGACACGTACGGTCGGCGTAGCAAATAGTAGAAACACAAAGACACAGGAA
CGCCGTCACATAGCGTCGCATTCCTTGCGGGAGTTTGACAGAGACGTCGCCCGCGGCGACCACGTCCGCTTTCTTCCACGCTTCCTTGCTCGCCATCGCA
AAATGACAAAATGAGAGGATCGCACCGTAACACTCATGAGTTTTTTTTCTACCAATCACAAAAAGAGCCACTTCAACTTGCGTCACTGTTGCATGCTTGA
ACACCAAACAAAATGACACGGAGCAATTAGGTTTACAAGATCGGACTAACGGGAATTGGAGGTCTCTCCTAGAGGCGACTTGGCGCGATACCGCTTTGGG
GCAGCAAGGGCGGACGTTTTTGTCGTTTTGCGAGGTCCTGCACTTGACACCTTCATGCTCCTATGCGGGTGGGCGACCACCGGTTTCTTTTTGTGTAGCG
CGGAAGACCCTACCTTCCTGAGTTTGGACGGGGTGGTGTTGACTGCATTGGCGGTAGTAGCAGGTTTGGTCTCAGCTCGTGATTCTGCGCCCTTAGCAGT
TGTGCTGGACTCGGTGGATGCCGAGTTCACAGATTCCTGGCTGCTTGAAGCAATGGCAGCTCCAGTGGCCTCGATGCTGACTGGAATATCGATAGGGTCT
TGAGCGGCGGTGTCGTCGACGACATTATCAATGGCATCTGGACTAGTACTTGCATCGCTCAATCTCCTTCGCTTGTGACCAGAAATCGGTTCACTAGTTG
ACGCAGTGGCATAGATGGATGAATTCTCAACGACGCTCAACTGCTGAGACGAAACCTTGGTAGCCCCAAAGGAAGGGAATGGCCGGTCATCCTTTTTCAT
TGGGGTCTTTCCCGTCCGTTCATTAATCTAAACAGTGAAAAAAAAAACAATTATTAACAAGGATTATTAGATGCGGCATCCAGAAAGCAGTGACAATTAC
CTTTCTCTTCTTCATGTACGTCTCCATTGCCTGTAATTGCTGCGTAGATGATTCAGTGGCTTCTCCAACAATTTCCTTTCCAAGTTCTGCTGCTGACTCA
AGTTTGTCCTTCGTGTTCGCAATTTTTGTATGAAGTCCTTCCTCCAACGCCTTGCACCCGCCATTCAATAGCTGTCGGAGCTCTTCATGATCGCCTAAGA
ACTGCATCAATTGCTCTTGCCGCTTATTCGAGACTTCAGCATCAGTCTTCGAGTGGTTTTTCATCAGAGAAGACATGACTTCCGTGTGCTTTCTAGCGAG
ACTAGCAGCATCGCTACTCCACGCAGTCTGCGATTGCTCATGCGACTGAATGAGCTCCATTTGCCGTGCAGTAGTCTCACCAAGTTGCCCTCGCATCTCA
GACAAACGCTCGCGAAGCCCAGCCGTCTCGCTTTCGTGTTTTGAGTTTTGACCACCTATGGCCTGCACGAAGCCCTTCATTTCTTGCTCCGTGATTGTCT
GAATATACGAGAGCTGTTTGTGCTGTTTCTTAGCGTTTCCTTCAATGATCAAGGTCTGCTCGTCGAGCTTCTGTGCTTGGCTTTGGATACACTCGTCGAT
GTACTGAGCTAGATGTGCCTTCATGCCGTTTAGTTCCTCTTGCTGCTGAGCTTGACTGTCCTTCAGCGCAGCTGTGAGTGCCGTCTTGCTTTCGTCAAGT
TTCTTGGATTGTTTCTCGATTGACATGTCGATTGCAACCTGAAGTTCTAGCAGCTTGTCGCTTTGCTCGGTCAGGAAGTTACTCAACTCTTGGCGAGAAC
CCTCCAATGTTGACTGTACGCTCTCCAGGAATGACACCGTCCGTGATTTAGACGAAGCCAGGTCTTCAGTGATAGCAGTAGCGTGGCTCTTCGACATATC
AACAAACTTCTCGAGCTGTTGCTGCATCATTTCCTGCTGTTCTTTCATCGACAAGACCACTTCTTCTCGCTGAGCACGGCTTTCGTTGTCATCGTCAGCG
AATGATTTGGAAGTCTGCGCTCTGCGCTCTTCGACAAGACCTTGAAGTGCATTCAGACTCGTGACCAAACCATCCACGTCGGTTGAGTGACCTGTCTGCA
GCTCACGTAGAGCGTTCGACACATCCTGAAACATCCCATCTTGATTTTTCTTGTGTTTTGCCAGCCGCTCCAGGAACATGTTAATCTGCGACTGCGAGTC
ACTTCGATACGAAGTTGCCAATGCTGTGTTCGCTTCCTCTGCGCGCTGGGAGTTCTCTACAATCAAGTGAACAATAGAAAAACATGAGCTAGGTAATCAC
AGCATCAGAAGCGGACAAAAATCTGCTTACCAATCTTCGTCACAAGCTGAGCGGCGCGCTTGTCACTTTCACTGTACAGCTTGGCGGCAGCAGCTCCATT
TGCAAGTAGCGTCTTCTCGTTATCTTGAAAATCTTTCAGCACCGCATGGACTTGTTGCAGCTCTTGTGTTGTCTTCTCCAGCGTTTCTTTAGCAGACGTA
AGTTCACCTTCAGTGGCAGCTAATTTGTTGCTCACCTCCTGTTTCTCTTGTGTCAGTGTTGCCACCTCGCTCGCATGTTTTTCAGCGACTTCTTCAAGCT
CTTTGCAAGACGAATCTCTCGCCTTGAGCATCTCTTCCAGCTCCCCCAGTTGCGCGCCCTGACCAGCTAACCGCTCTTGCATATCCGTGAGCTGTTCCAG
CGGAAGATACACGCCGTCTTTCAGTCTTGCAGCGCGCAAAGCAGAGCGAAGCGTCTCGATCTCACTCCCAAAATCACTCAGCAGTCCAGCCTTGGTCATC
TTTTGGTTCAACTCAGGCTTATTCTTGATGTTTTTGGCACGGAATGCATACTCCAGTGTACTCAGAGTCTCATCAAGGCTATCAGCACATGGAGCTAACG
TTGCAATAATCGTCGTCTTCGCCCGTCCTCCAAGGGATTCCTGCAGCAAGCGCGTAAGCTTACTATCGCGATACGGGACGTGCGGGAGGTTGTCCACCAG
GGCCGTAATGACACGTCCCAACGTCAATAAACTCTGGTTGATCGTTCCAGCCTCGCGCGCTCTGGCATTGCGAGCTCCCGAGCGACCCACGCACTCAGAA
CCTGCCAGGTCCACCAGGTTTAACTGCCCTACGCGAAGTAGATCCTCTCCTGCTGCGTTGTGCTCCTTGCTGTGAATCCTAATGGTGAAAATACTATGCG
AGCGACTCGAGTTCTCGTTCATCAGCGTCTCCGACGTGATGCGATTCTTCACGCCTGTATTGACGAGCTCGTACACGTGTTTAGCTGTGGTGGCGGTGAT
TTCCAGCAAGTTCATGCAGTAGATCCCGCCTCTTTTGACGTCCTCCATCAGTCTCAGCTTCTTGTCCGTGTCTGGGTCCAATAAGTCCTTGAGTTCTTCG
TTGTAGAGTTGCAGGAAGGACACACGAACACTAAACTCCTCTCCTCTGGCCTCCAGAGCGTCGAAAATGCAGTGCACGCTGCGCGGGATGATGCCAGCCG
ACTCGCTGCCCGGAGACAAGTCGCCCTGCATTGTGTACGTCTTACCTGTGCCCGTCTGGCCATAGGCGAAGACTGTGCAGTTGTAGCCAGCGAGAGCCTC
GTCCACCGCGGGGCGTACTACGGACGTGAATACGTCCTTCTGAGTCGAGTACTGTCCGAAGACGCGGTCGAAAGTGTATGTCTTGCGCTTGACCACAGCG
AGCTCGTTCGAGTTGGGTTTACATTGTAGGACGGCGCCACGTCCAGCCGCCTTCTCGCGGCTATTGAGTGGACGGCAACGCACCGCCACCTGCACGTTCG
TGGGCAAGGGCGGCGGTGGCGCTTCGTGGTTAGAGGACGACGACATGCGGCGATTCTCGCTGCTGTCCTCGGTCATGGAGGCGGTAAGCTGCCTACGACG
ACTTTGGGATTTGAATCGCAATTCAAAACGCGCGCGGAAACAGAGTGATGGTCTATTGTCCTATTTGGTGTTTGATCCACCAAAATGATGTTTGAGTATT
TGAGGATTACTTTATGAGGGAATTACTCATTGGTGTTGAGGAACACCATTTTACCTACTGACCAACCAACCTGCCTTGAAGCGGCAGTTGACTTTGTTCG
AGCTGTTGAGTGGCAATGACGCAGCCCAAGGTGAACGAGACGCTGCTGGACGGACAGAAGCCCTTCGCGGAATGCGAGTTCGGTCTGGATCGCCGCCTCA
CCAAGGCGGTAGCTAAGATGCGCTTTGTGCATGCCACATTGGTGCAGGTGCACTGCATCCCGCTGGCACTGCAGGGCAAGGACTTGCTGGTGCGCGCTCG
CACGGGTTCCGGTAAGACGGCGGCTTTCGCATTGCCGTTGCTGCACAAGATTCTTCAGCACAAGCAGGATACACCCGCCAGTGAGCCGGCTGTACGCGCA
CTGGTGCTGGTGCCTACCAAGGAGCTGGTGGAGCAGACCCGCCGCCACATGATGGACCTCATGTACTACTGCCAGGACACAGTGAGTCTGCTGGCACTAG
GCGGCCAGAGTATGAACGCACAGCAGGCGCTGCTGCGTGACGCGCCTGACGTCCTGGTGGCCACACCTGGTCGTCTTGTGGCTCATCTGGAAGCTGGCAA
CCTCACACTCAAGGACTCTGTGCAGACCGTCGTCATTGATGAAGCCGATCTAGTGCTATCATTCGGATACGGCGAAGACATTCGCACTATTTTCAATGCG
CTGCCCAAGGCGTGTCAGACGTTCTGTATGTCTGCTACGCTTAGTCCTGAATTGGAGAAGCTGAAGCGCTCCGTCCTGCACAACCCGGCGGTCGTCAAGC
TCGAGGAGGGAGCAACAGACGGAAAACTCCAACAGTTCTACTTGCCAGTCAAGGCGTCGGACAAGGACCTGCTGCTGTATGCTCTACTGCGACTTGGCGT
CGTGAGCGGCAAGGTCATCTTCTTCGTCAACTCGACAGATGCGGCCTACCGCCTGAAGCTATTCTTTGAGCAATTCGTGATCAAGAGCGCAGTTCTGAAT
GCCAAACTACCGCACAACTCCCGACAGCACATTATTGAGGAGTTCAACCGAGGTCTCTTCGACTACCTCATCGCTACGGACGACAGCGTAGACCGCGACG
AAGTTGGCGACGAGGACGAAGACGAAGCTGAGGAAGAGGAGCCAGAAGAGAACGATGAAGAGAATGAAACTGCCAGTGAAGAGGAAGAAGAAGAGGATGA
TGACAAATCGGATGCTGAGTCTGTCGCTGAGGAGGACGAAGAGAAGGACAGTGATAAAGAAGAACAGGAGGACAGTGAGAAGGAGGACGATGAAAGCATG
GATAGCGACAAGGAAGAAGCTTCTGATAATGAGGACAGTGACAACGATGAGCAGGAAACGAAAGCTGTGGGCTCTAAGCGTGGACGTGCTGACGATGAGA
GCTACGGTGTATCTCGCGGTGTTGACTTCCGCGGTGTGCAGTTTGTTATTAATGTGGACTTCCCCAAGAGTGTCCGTGCGTACACACACCGCATCGGACG
TACTGCGCGTGGTGGAGCCTCCGGTACAGCTCTGTCTCTCGTGTCCAAGGAAGATGCCAAGGAGGAGCGTGCGCTGAAGCGTGTGCAGGCCAAGCAGCAG
GCTGTGCTCTCCGAGACGAATGATGTTATTGCTCAGCCTGCTGAACTAGCTTTCGATCTCAAGGAAATCGATTGCTTCCGCTACCGTGTCGAGGATGTTC
GTCGCGCGGTCACGCGTGTGGCTGTGCGTGAGGCTCAATTGGCTGATGTCAAGAAGGAGATGCTGAACTCGGATCGTCTGGCGGCACATTTCCAAGCGAA
TCCGCGTGATCTCAACATGCTGGAGCACGACAAGGTGGTGGGCTCTGCGCCAGTACAGCCCCATTTGGCGACAATCCCGGACTATCTTGTGCCTACCGAG
CTGCAGCCGCCGGCACCAGGACGCACCAAGAAGAAACTGAACAAACACAACAAGCGACAGCGTCTCGCTGACGGCAAGAGACGTACGGACAATGACCCGC
TGCACACGTTCGTGGCTCCTGATGCTGATGACAAGAAACAGACTGTAGAAGACCGTATCAGCTACGGCAACAGCGGCGTGGGTAAGAGTACTGCTGGTCG
TCAGAAGTGGAAGAAACAGCACCGTAAGGGCCACTTCAACCCCAAGACTATTGCCAAGAAGAAGTACAAGATGCGCATGGGTGCCACTCATTAAACAAGC
TGAAACTTGGGAGTCACGGTACCAGGTATAGGGGCCTTTGTTCCTGTTTTTGCTTGCCAAATAGATACACGTTTTTTGCTTCACTTTTATTGAAGGTTGC
GATCAAGAGTTGAAGCGAACGCTGGCATTGATACTGGTCGACTGGTGCCAAAATATCGCAAAGCAGCAGGTGGAGCGTTGCTAGGTGGAACTAACAACGC
GATACTCTCTGGATCTCCTTGTAGTTGTTGCTGTACGATTCGCTGCCAGAGTTCATCACTAGCAAGCTGTACGACTCGTTCCGTCGGGAGTTCTGTGTTG
GCTACGTCGACTTCGACGAACGCAGAGTTTGCGCGAGGCTGCAGTGAGTTGGCCATCATCCGTTTTCGGTCGTACACGTAGTCTAGCAACTGTAGACTGC
GCATGTGCTCAGCGTGTTCGCGTTCCACACGAGCTAATCGTTTGTGGTCTGCGTCAGTGCTTGCTGTGGCTCGTGCAGCCCGTATTTCAGGTGGAGCGGG
GATAATTGTGCTCGTCGAAGAGGATAGCGTGAACAAAGACTTGTTACGACGCACCACTTCTTCACGAAGTGACCGGAAGTCACGTGACAAGAGCAATTCT
TCTGTAGCAAGAGCTTTCATAGCACACACCTCACGAGCTCGTTGCGCCCCTGTCTCCTGTTCAACGGCCTGACAGTGAGCTCTATGTAGTTGACTCCAGT
AACGAGTCTGGTCGGTGCGAGCAATTTGCATGTCAAGTTCGTTCGCGCGGAGATCGCGTCCTTCCTCGTTATGTACGTGACGAGAGATCATGGCTACACT
TGCACTGAACGCGCGTGCAATCTCTGCACTTTGTTGTCTCGCTCGTCGAGCCATCTCGTCAGCCTCTTTTTTCTTTCGACGTTGATGTTGCTTAGCGTTT
TTGAGTTTAGTTATCGCTGTCAAAGTTGCAGGATCGGGTTTGTTGTGAGAACAGTATTTGGCATGCAGCAATGCTGGAGCAGAAGCCGACGAAGTAAGTG
ACGGTACTTGTGGCGGAGGGTTGCGAGCGTATGCCTCGTAGCTGAAAGCTCTTGTGGCATCACTTTCATGTGCAAGCTGGTCAAACGGCGGTTGAGTAGC
CTGCGTTGGAGACTGCTGATGGTCGTATTCCAACGGCATTAGTTTTTGGCACTTCCCTTTTCCTGCTTTCATCACACTTTGCTGCTTCTGCCATGTTGAG
AGATTTCGTACGTGTTCGATTAGAAAAGTCTCAGTGAACCAGAGTTGACATCCTTGGATGAACTGGCTAACCGAGACTGTGGGTCCAGTCGTTGATGTTG
GATCCAGTGAGTTTGAGGGTGGCAAGCGTTGTTCCCATCGCCGAAAAGCGGCATTATCTACTTGCAGTCCATGAAAACGTAGCAATGGCTTTATCTGCAC
TAGCTTGATACGTCGAGTATGCCGCACTTGCGGATCATAAGTCACTATGAGTTTCTCGCATGCAGCCATGAATGCCAACTGACGGCTCTGTGAAGCATTA
GCAATCCCGCCATTGGGTGATAATGGTAGGGCGGACGTTGGTAGTTCTGAAGCAGATTTTGAAGTGGAACTCTCGTGGGCGAGTGGACGTCGATCAAGTT
GCTTGGCATATGGCGGCGGGCGATGCAGCATACGCTTCACAAGCTCGCGATCGCGTACGATTGCTCCTAGAGTTTTGATTGCTGCAGTTGATTGAGGCTG
GACAAGCGGAACAGCTTGGCGGTACAACTCCAGCATTTTGTCGTCACCTTCACGAGATCTAAGCGTGCGGTCGAAGCTACTCTCATCGTCACTCTCTGCG
GGGTTGCTGTCAGAGCCTTCGTCGTCGGGTCGAGACAACCGGAAAGGCAGAAGGCATTCCACAAAGGGAGGTGTCGTCTTCATGGGCTTCTGTATCAATG
AGGCCCATTCAGAAATAAATTTCTGGAGTCCTGGAAATAGATACATGAGCTTTATGAAACTAAGCGGTGATTGGCTGATGTTGTTGAAGTAAAGCTACAT
GGATACATTTTGCCTTGCACACGTCTTTCTACCGGTACAGTGGTAGACTACCACAGCGGTTGTGACTTCAGAGTAGCGGCTGTAAGATATTTGAATCACC
CAGCACACTGTGACGAATTCCGTAACACAGGTATACGATTAGACCCGCGCCTAGCCAGAGGAGCACACCGATCCTACAGCCCATACCAAGTCAGCACGAG
AGCATAGACAAACTCTCGAAATGAGCAAAATCAGCTTACCATCCTTCGCCAGGGATGCTCGCCACCATGTAAACATTGGCAAGAATCCCCATGCACGGCA
CAAATGGTACCAGTGGACATTGGAATGAACTGGTGAGAGCACTGCAGATACAAGAAGAGAACATGATTAGGATACGTACTTCAAATAAATAAGAAGAAGC
GAAGCCGACTCTACGTACTCAAGCTTCCCCAGTCGGTAAATGAACACGAATGAAGCAACTACCAAAGCAGCAAACACAGCTTGAATCGTCCACGGTAGAT
CGAAAACGAAAGATAACGACAGCGCGAAACAAGATACCACGAACAGTAGCACACGCTGAACGACAGCCGCTCCACTGAGACTCGGACGCATACGCAGCAG
TAGTACGCCAGCATTCACAAAGGTGAAGACTTGTAGTGTCCCACAAGAAATTACGTTGGCCAGAAAGCTGAGATCAAATACGAACGCAATGACAGCGACC
AAAGCACCAGTAAATATCGTACTGGCAACAGGAACGTGTGTCCGATGGTGTAGCTTGGCGAATACTGATGGCAGCAAACCATCTTTAGCCATCTGGTAGA
AGATACGCGGTTGGCCCATGAGGCAAGTAAACGCAGCAGTCGTAAGCCCAAAAATGGAACCGAAGGACACGATACGTCCAGCCCACGGCGCGCCATGGAA
AGTAAACGCATTCACCAGAGGAACCTCAGTTCCGAGGATGTCAACCGGTGCCATTCCGGTCACGACTAGCGAAACACCGACGTAAATGGTCATAGAGATC
AGTAAAGACCCAATAATTCCTTTGGGTAGTGTGCGCTGGGGCTCGTGCACCTCTTCGGCTAGACAAGCCACCATATCAAAACCCAAGTACGCGAAAAAGA
CCACGCCAGCTCCTGTCATAACGCCGTGTACTCCTGCAGGCATGAAAGGTTCCCAGTGCGTAGTGTCCACTTCAGTGCTTCCAAACGCAACCACAAAGAG
CAGCACTGATATATTCAGCGACGTCACAAATGCATTGAACTTGGCGGATTCCTGTCACAACACAATGGTCGTTTTAGCATCATCACCGCTACGTCAAAGC
TTGGATACTCACGTGAACCCCGGCAAGAAGGATGAAGGTGCAGCATATGATGAGAAATACGGCCAGGATGCTGCAGGAGATACCTAGAAACTCTGTTTGC
ACGAGCCAACGTGGGAGATGAAGACCCAAATGTTGTAGGAACAAGTATGCGTACGAGGCCCAACTTCGTGCAATTCCAGCTACAGTATCAGAATAGCAGC
GTAAGACCCTCGCACCAAACAGCCAGTCATCCTTGCTCATTTACCTGCCGAGATGCCGTACCCAAGCGTTAGATTCCACCCAATAAGCCACGCAGCCAAC
TCGCCAAAGGTGATATACACGAACGTATATGCTGAGCCCGTGACCTTCACTCACATACAATTCAGTGTCTCCCTCACACCCTTCAATAAGTCTTGCAACG
TACAGGAACACGAGCTGCAAACTCTGAGTACGTGAGCGACGTGAAGATGCAGGCAATACCACTGACGAGGAAGGAAAGAGAGATGCTCGGTCCAGCAATC
TGAGCACCTACACCAACGAGCGAGTAGACGCCGGCACCCACTGAGCAGCCCACACCATACGCCACCAAGTCCACCAGTGTCAAGCACTGCTTCAATGAGC
TAGTTCCAATCTCACAGCGTGATAATGGCTTCACACGGCTTGCAGCCTCCAGGAATTGATCCATGGCGAATGCAATATTGAACGGCGGAAAGCTCAGCTG
CCTCTTGGCTACATTTGGGTGAGTCGTTCCGTCAGTGCAAGTGTCCTTTCAGCCAAGAATGTGTACTTCGATATGATTGGATGAAATGGAGTCGTATCCA
AAAAGGGGGCATCAGAGTCGGAAAGAGCGAATATGGCATCCGTTCCTACCGAAGATGAGCGCACGCAGGTGCTGAACGCGTACAAGGCTAAGGTCATGGA
GCACCGCGAAATGGAGAGCAGGTGCGTCGCTTTCTCTTAATATAAAAGTTGCCGTCTAAAACCTCCTAGATCCAGCGTCATACTGCTGTGATCTTCTGCT
TTGTCTCGAACATATCTAACCTTTATACGTCGCTTTCTCATGCAATTCAGAGTGAAGAACATGCGTGAAAACGTCAAAGCGCTTGTGAAGGAGTTCAATA
AGACAGAGGATGACCTCAAGGCGCTACAGGTACACAATTAACGCTTTTTATTCCTTCTCTACAGCTCCCTAAAGTCACGGCATTTTCGTTCTGCAGAGTG
TGGGTCAAATCATCGGCGAGGTGTTGCGTCAGCTGGACGAAGACCGCTTCATCGTCAAAGCTTCTAGCGGTCCGCGCTACGTCGTCGGATGCCGCGCCAA
GGTGGACAAGAGCAAGCTCAAGTCGGGCACACGTGTGGCGCTGGACATGACGACACTCACCATCATGCGCTACCTGCCACGTGAAGTGGATCCGACAGTG
TATCACATGCTGAACGAGGATGCTGGCAACGTGTCGTTCTCGAGCATTGGCGGTCTGAACGAGCAGATCCGTGAGCTCCGCGAGGTCATCGAGCTGCCTC
TCACCAACCCGGAGCTGTTCCATCGCGTCGGTATCAAACCACCCAAGGGTGTGCTACTGTACGGTCCACCCGGTACGGGAAAAACTCTTCTGGCTCGTGC
ACTGGCTTGTAACATCAACGCCACCTTCTTGAAGGTTGTGGCTAGTGCCATTGTGGACAAATACATTGGTGAGAGTGCCCGTGTGATCCGTGAGATGTTC
GGATACGCCCGAGACCACCAGCCGTGCGTCATCTTTATGGATGAAATCGATGCTATTGGTGGAAGTCGTTATTCGGAGGGAACGTCAGCAGATCGAGAGA
TTCAACGTACGTTGATGGAGCTGTTGAACCAGTTGGATGGCTTCGACGCTCTTGGACAAGTGAAAATGGTCATGGCGACCAACCGACCGGATATACTGGA
CCCTGCACTGCTACGTCCTGGTCGTTTGGACCGTAAGATTGAGATTCCGCTGCCAAACGAGGCTTCGCGTATGGATATTCTCAAGATCCACTCGGGTCCT
ATCACCAAGAAGGGCGAGATCGACTACGAATCTATCGTCAAGCTCACAGACGGCTTCAATGGTGCCGATATGCGGAATGTGTGTACCGAAGCAGGTATGT
TCGCTATCCGTGCCGACCGCGAGTACGTCGTGGAGGAAGATTTCATGAAGGCGGCGCGGAAACTGGCCGAGACCAAGAAACTCGAATCCAAGATGGACTA
CAGCAAGGTTTAAATTTGCTAGCTGATGCACATTTCCGAGTTATCCTGCTCTTGTCAAGAGTCGAGCAGATACATGAAAAAGGGAAAATAAACATGGCGG
TGGGTTGAATCTTGCTTGGTATTGATGCCATTGCAGTCGTGTTCTTTATTTGATCTGGTTATTTAGGGGGTTAGCTGCACGTAAAAACCGCAATTTTTTC
GCCGTTCTTGTAGCGTGGCGTGTTAGAGATGGCGTCAGCGGGTATGGAGTGCTGCGAGTTGGTGGGCCTTATGGGAGATGTGGCCTACCAGCGTTGTAAA
TTATTACTTCAAGAACTGCGCAAGCTCCACCCGATCTTCGTGTCGCCACTGGATGGGATGATGGAAGTCGAATATCTCGAGTACTTGCAAAACCAGCAAG
ACAAAATCCCCAAGAGTAAGCGTGCGGAGTTGCAGCGAGCAACTCGGCCGATTATTCTGCTGTTGGATTCCTCAAATGACATGTTGGACGGAGAAGACGA
GCTGCTTGACTTTGCCATGGAGCGGACGCAGTTATCAAGAAACGAACTGCTAGCTGCTGCTGCATTTGGAGAAGTACTGGCTGTCGGTAGCGAAGATGAA
GGCAATGATAACTCCAGAAAAGACTATGGCGAGAAACTGGCACTAGCAGAAGAAACGCTGGAGACGAAGGCGGAAGAAGCAGCCCAGCAGACTCTGACAC
GCTATCGCGAGCTATCAGGACACTTGTATGCTTTCTTGGTGTTCGAGGTAGATGGTGTGGCACTGCCTCGCGTTGAGCTGGAGCTATTTCACGGTGTTTG
TCCTAAAACTTGCAAGAATTTCTTGGCACTGTGTGAGCACAAGGTCCCTGATCTAACGGATGAAAATCAACAATTGGGCTATCAGGGCAACCCAGTTCAC
CGTGTAGTGCGAGGTGGCTGGATACAAGCTGGTGATATCGCTGGTAATGGCCGAGGAGACGGACCTTGTCGATCTCTTTACGGTCTGGAGTTTCCAGACG
AGAGCTTTGCTGTTTCTCACAATGCTGCAGGCATTCTGGTAAGTCAGTAGGTTACTTCTTCTCTCTCTATCTGCTTGTTCTGTCATTTCACAGGCACAAT
TCTTTTGTTCCGTCTACAGTCCATGGCGAATATTGGTCCACATACAAACGGCTCGCAGTTCTTCATCACTCTCGCGCCGCAACCTTGGCTTGATCGTCGT
AAAGGTACTGCAATATGAGCTCTGTATCAATACTGAAGTATATGTTGACTAACGCTTGGTTTGTTCGTGTTGACGTTCGGCAGTGGCATTCGGTCGAGTG
GTAAGTGGTTGGCGGACTGTGATGACTATCGGAAGTCTAGAAACTCGTCAGGAACGACCTTGTGTGCCCTGCACCATTGTCGATAGCGGAAGACTCCAAT
GAGG