Description :
From Genome Similarity Track
Location :
Scaffold_7:13807- 16106
Sequence
2299 bases(100 bases per row)
CTCCCGGCGGACCGTGGCGTACGGCACGAGATCGATTTCGTGCCCAGGTCAAAAATATTTTATTACACGGCAATGACCACTTTCACGGGATCAAGTTGAA
GCGATTTAAGGGCGACAGCGTGCGTGAAAGCAACTCACCCTATTCTAGTCCTAAGTTCTGCACCCAGAAAATAACAGGAGGATGGCGGATTTTCCACGCC
TATAAAAAGCTGAACGACGCAAAAATTCAAGCCCACACCCCGATGCCTCGCAAGGACATGGTTCTTGACACCAGGTCTGGAAGTACCATCTTTTCATCGC
TGGGCCTCACAGACGGTTTTTACCAGATCCTGATGCGCCCTCAAGATGTTCCCCTCACTGCTGTGATCCCGCCTAGTGACATGCTATGGGATTGCATCGT
GATACCGCAGGGGCTCATGAACGCCCCTGCTACGTTTAATCGAATGGTGTTGGATGTGCTTCGTCCGTTCCGTTATCTTTCCCCGAGTTACTTCGATGAT
ATCTTTGTGCATAGCCGCGCCACCAACGGCGCGATCAACCTCAAGGTCCACCTCGGACATCTTCGTACGGTGTTTGAAGCGATGTACGAGGATAAGATCT
AACAAACCTGAAAATTCCATCTTTTGCGCACCATAAACACTAGTGCTCGGTAGTTACGCCAGCGCAAAAGGGTCTCGTGCCGACTCTGAGCAGATCTCGT
CGATCTGTTCCTGGCCGGTACCATTAGAGCATAAGAACCTTCGTCAATGGCTCAGACTAGCTAACCACCTTCAATATTATTCCAAGTGCTTTGCTGCAGT
TATCCACCCATCGTGTCTGCTGCTGAAGAAGGACACCACATTGTCGTGGCGTCAGGAGCACCAGGATTCTTTTGAGGAAATCAAGAGAAGATTTTCAACA
TCACCAGTACTGGCGCTACCAGATCTCTTGAAACCATTCCATGTGGTCTTCGACGCGAGTAATTTTGCCATTGGGTGCGCTCTCATGCAACTTAGCAGCG
AAGGAGCACGACGAGTGGTCAGTTACCAATCGCGTCAGCTGAAGCGCTCCGAACGCAATTATCCGGTGCACGACAAGGAGTTGCTAGTTATTCGTTATGC
ACTCGTCAAGTTTCACGTCTATCTGCTTGCCGATCATAAATTCGCACTACACCGACCATGCCTCGTTACGCACAGCGACCGATATCCCCCATCTCAACCG
GCGCTTGGCGCGCTAGTTGTCGTCATCACTGAGTACAATTTTGTGGTACATTACAAGCCGGGCTCCAACAACATCCTCTCAACTCCCTGTCGAGCCGGTC
TGATTACGATCCGCGTGCAACTGCCACCGTCCCTGTTTTACCCGATGATAACGACGAAGATTGCGTTGCGGGCGGGCGTCACACTCGGCGTGCATGCAAC
ACGGGTCACCGCGGTAAATCTTCTTCGGACTGACATAGCGGAAGCTTACACCCAAGATGTGTACTACTCGCCCACCGTCCGGTACTGTCATTTCCCATCC
GATGAGTTGCTGTGCGGTCTCAAAGCGTCAGCTCGAGCCTAGATGTTGGTTATTCGCTCGAAGGCTACTTTTACTAAAGTATCAGATCGATCATTTTGAT
ACTCCGCGCATCGTCGTCCCGCTTGACAACGATCTTCGTACCCATATTCTCCACGAGCACCATGACAGCGAGACTAGTGGTCACTTAGGTCGCGGAAAGA
CCTACTTGTCCATGTCTCGCATGTTCTACTGGTCCCACATGTATTAGTGGGTTCGCAAATGGGTACGCCCATGCGAATTCTTTCAGCGCGTTAAGACGGC
TCCGTCATCCAATGCCCTATTGTACTCTTTACTGGTTGCGACTGAGTCATGGGACTCGGTCAGTATGGACTTCGTTTTTAGACTTCCTGTCGACGCGCAA
GGGCGCACTGGATTTTTAAGGTTGTCGACCGTTTTTAGCAAGATGGTGCATCTTGATCCTATCGCTGCGTTCATTACCACCGAGGACACCGCGGCGTTGT
TCCTTGACATCGTTTTCATCCACCACGGTCTGCCTTCTACAATTGTTTCAGACCGAGAACCTCTTTCAAGCCGCGTTCTGGTCGCGACTGTTTCCCTTTC
TAGGCACCCGTCTTCTGATGTCTACGGCTGCACATCCAGAGACGGATGGACAGACTGGGCGCGCAAATTGCGTCCTGGAGGATTTTCTGTGCATTCACGC
CGCCTCGTTTGCGTTATGGAGTGCATTCCTCTCCATGACCAAATGTTCCATGAACAACGCGGTCCACAAATTTTCCGAGTTGACGCCCTTCTTCGTCAA