Description :
From Genome Similarity Track
Location :
Scaffold_86:138066- 142036
Transcript NameFunction/comments
Phyra_72102glutamate synthase, putative
Phyra_83322leucine-rich repeat protein, putative

Sequence
3970 bases(100 bases per row)
ATGCAGTCCGCCGTGCGCCAGCGCCTGGCCTCTTCCTCCTCCGCAGCGTCCCGCGCGACGTCGCAGCTGCGCCGCGCCGCGTCCTCCACGGCCGCCGAGC
CCGTGTTCGCCAAACGCGACGGCTCCAAGGGCGAGATCAACAGTGCGCGCGCCTTCATCGAGTTCAAGCGCGAGGCAGACCCGTACCGCGACGTGAACGA
GCGCGTGCACGACTGGAACGAGATCAACTCGGGCCGTCGCGACCCCACGGAGCGCAAGATCCAGGCCGCGCGCTGCATGGACTGCGGCACGCCCTTCTGC
CAGACCAACACGGGCTGCCCCGTGAACAACCTCATCCCCGAGTGGAACGAGCTCGTGTACCGCGACGAGTGGAAGGAGGCCATCGACCGCCTGCACAAGA
CCAACAACTTCCCCGAGTTCACGGGCCGCGTGTGCCCCGCGCCCTGCGAGTCCGCGTGCGTCGCCGGTCTAGTGGATGACCCCATCACCATCAAGAACAC
CGAGTACGCCATCGTGGACCGCGCCTTTGAGGAGGGATGGATCGTGCCCCGCATCCCGCGCCGTAACGGCCTCCGTGTGGCCGTTGTGGGCTCGGGCCCC
GCAGGTCTCGCGGCCGCGGACCAACTCAACCAGAAGGGCTACCAGGTGACGGTCTACGAGCGCGAGGACCACGTTGGCGGCCTGCTCATGTACGGCATCC
CCAACATGAAGCTGGAGAAGAAAACGGTGACCCGTCGCGTGGATCTTCTGCGCGAGGAAGGCATCGAGTTCGTCACGAACGCCGAGATCGGTGTCTCGCT
GCCCGTGGAGAAGCTGCAGGCTGAAAATGACGCCGTCGTACTGGCGCTGGGCTCGACCGTCCCGCGCGACGTGGACATCCCCGGCCGCGACCTCAAGGGC
GTCCACTTCGCCATGGAATTCCTCACCAAGAACCAAAAGCGGCTACTGCTGACGGTTGACGGCAAGCTGCAGAGCGGCTGGGACCGTAACTTCGTCACGG
CCGAGGGCAAGGACGTCGTGGTCATTGGCGGCGGCGACACGGGCACGGACTGCATTGCTACGTCCATGCGTCACCGCTGCAAGTCGGTGGTGAACCTGGA
GCACAACCCGGAGCCTCCCGTCCAGCGCGCCCCGCAAAACCCCTGGCCGGAGTACCCGCGTATCTACGGTGTCGACTACGGCCACGCTGAGGTGCGCTCC
GTGTTTGGCGACGACCCGCGTAAGTACAGCCGCGTCACGAAGGCGTTCAAGGGCAACAAGGACAACGAGATCACCCACGTGGTGACGATCCTGGGCGATA
AGAACCCGGAGACCAACGAGATCACGGAGATCCCAGGCACGGAGGAGGAGATTCCGTGCGACCTGGTGCTGTTCGCCATGGGCTTTGTGCACCCGGAGCA
GAAGATCGCGGAGGATCTTGACCTGGAGGTGGACCAGCGCCGCAACATCCGCGCTGCATACGGCAACTACCAGACGTCAGTGGAGGGCGTGTTTGCCGCT
GGTGACTGTCGGCGCGGCCAGTCGCTGGTGGTGTGGGCCATCAACGAGGGCCGCGGCGTCGCGGACGCTGTGGAGAAGTACTTCCTGCAGGAGGGTTTCC
AGCCGGAGGTGTCCCAGAACCAGCGCTTCGGTTAAATTCATCCTCAGAAGACAGTATGTACCGGTAGACAATCGCATCAACAACTCACATCGATGCCTTC
AAGTGGAAGGCGTCGCCTGCAGCCGACGACACGGCGGTAAAGTCGTAGCTGGAAGAGAATCAGCAGAGAACAGCGCGGCGATATGAGCAGCGAGCAGAGC
GATGTAAAGATGAGGGATAATTATTGTAATAGCAGAGAGGTGAATCCGCTGGAAACGAGTTGCATCTGCTGTTTGATGCATCCGTCTCAAGACCAGCCAA
GTGGTCGAGGAATCCGCGTCGAGACCGTCAATGCGCAAACGGAGGACATCAAATGAGCGTGGATATGAATGGAGCATCTACGTGTTACATCTCGGCTTTA
CTGGATGAGAGCTCTACATGCGGATGATGGGCACTCGGCCGCGCAGTTTCGCGACCCCGTCTTTCAGGACCTCGTCGTTCACCCGGTTGTAGCGCAGGTC
CAGCACCCGGACGCCAGTGAGCATGCTCACATCCGTCACCTTGCAGCAGTCCGAGAGATTGAGTTGGTGCACGTTTCGCAGAGCCGACACGTCCTCAAGC
TGCACGCAGCCGGAGAGGTTGAGCGTGTGCACGTTGGCCAACGCAGTGACGTCGCGGACGTTCGGGCAATGGCGCAGTGACAGCGTGTGAACCGTTTCTA
AGGCCGAGACGTCCTCGATGCGGGGACAGTAGCTGAGATCGAGTTCGCGGGCGTGTGCAAGCGGCGACACGTCCACGAGCTTGGAGCATCCAGCGAGCTT
GACGATCCGAGCACTTTGGGCCAGCGGACGCACATCTTGGAGGGCGTCACAGAACCGCAAGTCGACGTCTTGCGCTCCGGCGAGGAAGCTGATGTCGCTG
ATGGCACTGCACCCGGACAGGTTCACCTTTGTCAGGCACTCGGCAGACTTCGCCAGCACTTTGATGTCCTCGAGCTTTTCGCAACGGTAGGCCCCAATGC
TGTGCACTTGGCGCAGTGACGACCCGAGCGAACGCAGGTTCTTGCAGAAGCTCACGTCGAGCTCGCGTACGCGAGTGAGGCCATCGAGTTCTGTCAGTTG
GGTGCATCGTGACAGCACAAGGCGGTCAAGTGCAGGCAGATGTTGCAGCTCGGAGCTTGTAAATCCCGTGCAGCCCGAGAGCTCGAGCTCGCGTAGACTG
CAACTTGCTCTCAGCGCCGAGAGGTCCGTTACCGCGTCGCATTGCCGAAGCGAAAGCTCCTGTACACCACTGCCCAGCGCGGAAATGTCGCTCACGTGTC
TGCAGAGCGCAAGCTGGAGCTTGGACACGCGTCCTAGTGCGCTCACATCCGTGACGTTGATGCACCCTGTGAGGTCCAAGTCCTGTACACCGCCGAGTGC
CGAGACGTCGACGATGCCCGAGCACTTGCGCAGTTTGAGAGTGTGAACTGTGCCGAGGCCGCTGACGTCGGTCACGTTGATGCAGCCGGAGAGGTTCAAC
TCGTGGACATTGCCCAATGTGCTGACGTTCCTCACATTCGCGCAGCCACCCAGATTCAGCTCGTACACGTTGCCGAGTGCACTCACGTCACTTACGTCGG
GACAATTACGCAGACTTAGACGGTGCACATGACTCAGCGGGCTCACATCGCTGACACCGCGACACACGTTGAGATGCACCGACTCGCACTTTGCCAGCGG
TGTGAGGTCTGTAACAGTGTGGCAATAGGACAAGTCCACGTGCTGAGAATGACTCAGGAACGAAACGTCCTCAAGAAAACTGCAGTAGCTCAGGTCCACC
TCGCGAATGCCGGACAACCAGTGCAGTCCGTCGATCTGGCTGCAGCCGCTCAGTCCAAGCTCCCGCAAGCGATTCACCCCATCGAATAAATTCACGCGCA
CGATTCCTGACAAGTTCAACCGCCTCACTTGGCTGTTGTCGCCGACTTGGATGCAATCTCGAAGCACTTTGGGGCAGCTATACCGCATCGGAATGCTCAC
GCCGTCTTCGTCGGTGTAGCTCTCGTTCGACACTTGAGCTGGTTCAGGCTCTGGGGCGGGTTGGTTGTCCTGGTGGTCGACGATGAGGCCACCAGCAGCG
TTCACGTTGTAGTGAATGCTTTCGTGTATCTCCGGTCCATCGCCGACAGGTTGAAAAGCCACGTTGCGCAGGTTGTGCCATTTCCTCAACACTCGGAGCA
GCTCTGGAATGGTGCACACCAGCGAGGCCTCGGCTTGAATCTGAATCTGTTTGTGCACGATGTCGTAGAAGAATCGATTGAGCTCTGCCAACGCCACCGC
TTCGTCCAACGAGAGGAATGGGATCAAGTGCCCATCCCAGAGCTCCACGGGCATCGTGTGCTGGAGGTGA