Description :
From Genome Similarity Track
Location :
Scaffold_254:13804- 15265
Transcript NameFunction/comments
Albla_Nc14108490
Albla_Nc14108500conserved hypothetical protein

Sequence
1461 bases(100 bases per row)
TTTTTCCACGAAAGCGCAGTCCAGTAAATTGAACATTTAAAACATCGTGCTGATACTTTTCATTGTCACATGCCTGATTGGAGACGGATGATTGGCCTTG
AAAAGGCCTTTTGTGAAATGATTCGGTAGGGACAGGTATGTTAATTGGATGCTTGTTATCAGGATAAATCACCAAAAAGACCCATTTTCCATTTATTTTT
ACTGTGGGGAGTGCTATCACGCTTTCTGCTGGTGTGCTTTCTGAACTTTTTAGAACCTCGAGATGCAGATGGCCACGTGTAGATGTGGACGTTGATTTCC
AAATAATCTGAGTAGCAAAGAGCTGAAATAAAATAGCTTTCATAGACCCAAATTATCAAAATCGCAGTTTTGTTCTTGTCAATCGAAAGTCTGGGGATAT
GATCGTACTTTAGATGTACAATTTACACATCCCCTTTTAGCAGCTGACATTCCCACGTTTGCAGCGATTACAGAATGTTGCTTTAGCAGTAATATATTAT
TGAATTGACGATGGCGTCATAGTTTGCGCAAACGTGACCAGTGTGCAAAAAACGTACTTGTCGAATACTCTGTCGAGTTCGATATTTTCTCACTGCTTTC
GCTAAAAATCTACGTGCAGCGCTTCATATGAAAACCTACCTGCGGGTCCTATTTTTTAGAACAACTGAGCTGTACTTTATAAGTTAAGACGCTCAAGATG
AGCACGATGTTCACGAGGAAACTAGGCGCAAGACAAAAATATGACATTCAAGGTTTTGACTCAGTTTACTGCAGGACCTATGACTGAAGTCTCATATCAA
TTCTCGTCCCTATGTGCACTGCGATCGTAGTGCATATCGCGATCGTATAAGAATATTCGCTCAGGTGATCTCACAACAACTCTTCAATCGCGTCACAGGG
TCCCAACGACTGTCACCGGGTTTGAACGCACATTTTCGACTAGATTTACTGTAGGTTAGAGATTAGTCTGGCCCACTCTAAATGTGGGCTAATAAAACAC
TTCATTTGATTGTGAGCAGATACAGTAATAAGGTAAACTATTTGAGCTATATTTTGAGTACCTCTACAACATGATATCCGTTCCTGCAGGTCTCGCCTAC
AAACAAACAAGCTAACACGTGAGACGGTCATACCTGATACAGGATACAAATGGACCTCTACGAAGGATTCGAACTGCCAAAAGCCGAAAATCGACCTATA
GTAACCAAACAATTTGCTCCCACGAGTGCTTTATTAGATCCCATTGCCGATGTTCCACATAGCAACTCGCAATCAAAACGTAAGCGACTCACAAAGGATT
TTGATCTCGACTTTTCGCTACTCAAATTACAGCGCTGTATGGTAAAAGCCCCTAAATCATAACAAATTTGCTTAAACTCACTATCCATCTTGTAGAAAAG
TCCAAGTCGATTCCCCAAGGCTAGCGAGCTGTTCTGCCAACTAATGGACAGTCATCTCAAT