Description :
From Genome Similarity Track
Location :
Scaffold_476:13803- 18966
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_476-snap-gene-0.12Mdc1 protein
Pytul_var.sporangiiferummaker-pug3_contig_476-snap-gene-0.13Conserved gene of unknown function

Sequence
5163 bases(100 bases per row)
AGATGGTTCTGCTCGAAATCGATATGCTGCTGCAGGATGCTGCTCAGGATCAGCTCCGGTGAATAGATCCGCTGCGGGTTCGCACTCACCAACGACTTTT
GCACCGACGCCACGCCCAACGCGGCTTCACTTGTGATCACCAAGTCCGACGGACCAGCACTGCCTTTCACCTCGGCCTTGCCGCCCGCACACTCTACGAT
CTTTACCAGGTCTTTCACGGGAGGCAACACCGACTTGTGGTTCGTGATGAACACGGTGTGGCCGACAAAGAGCTGGCGTCTTTGCTCTGGTGTAAACTCG
TACATGGTCTTATGCAGGTCGAAATGCCACTTTTGTTGCGCATTCGTGTCTTTCAGACAGTAGTCGGCCTCGTTCAGAGCGGCACCTACGCGAGCGGACT
CGTCGAGCCATTTCATGTCCAAAATATGCTGACAGCGTGAGATCCCACAGAGCAGCTTGACGGTGCGCTTGAGCTGGTTCTTTGGCGCGATGACGTGTGT
GGCTTTCTCGATATCATCTTCATACACCGCGTTCGCAATCGCTTTGATTTTCTTCCGAATCGCAGGAGTCGGCTCTATTCCGGTCAAGACGATGCGAATT
GTGGCTTCTGGCTTTTGTAAAAATCCAGGTGAGTCGTGGCTCAGCCTCCGTTTTTGGCTCGGCGGAGTTATGGCTAGATCCTTTCGACGACTTTTACCGT
TGACAGCGTTTAGTTGACTTAGTTGTGTTTCCCCGACTTCAATAGAGTTACCACCAGTAAGCTGAGATACGCGGTCACTTTCTGTCAGTTTTTTTGACTC
ATCGTCGTCTATGATGGCAGCCGTTCTCTTATTATTTCTCGCAGACGATGGCTTCGGAGCCTTTGTCGTCGCATGCTTTGCTCGTTTCGCTCGTCCTTGC
GCTTGTTCTGTACTCTCGGACGCATCAGTGGATTTTGCATCATTGTCGTCTGTTGTTTTCGATATCGGAGAACTCGTCAGTCGAATTCGTTTGGGCTTCT
TCCCGTCATTGTGATTTCCTACGTTCTCGCTTGACGTTGAATGCTCGGACGTTGAGCGCAATCGTGTCAGCTTCTGCATCGCGATATCAGTCTCGTGTAC
AGCAATCTCCTTTGCTTTTGACGCAGCTGATTGTATCCGTTGAAGATCACTATCGGGCTCTTCTTCGACTTCGGTTTCCGCGCCGCTACTACTCGATTCG
CCTTCAACGGAGGGCGTCGGTGTGCTTTGAAATTGTGAGCGGGATACATACACCGGTGCTTTTTTCTTCGCCGCGTCTCTCTCTGCCTCGGTTTCCTGCT
GCTGAAAGGACGCTGCGAGTGAGGAAAGTCCATCGATTGGACCGTCCTGTGCGAGCATGTCGTCCGACATATCGGACTCGGCGCCTTCGTCGTCACTTGT
GGCATTGTTCGTGCCGTTTGCAGGATTGCCCGACGCTGGCACAACCAGCTCCTCTTCCTCAATCTTTCGATGCGCCGTCCGCAATCCTATTCTCCATATC
ATCAACGTGTTAATACCAACTTTCAAGGCATTTCCGCCATGTAATATATCACATCGAGATCCATATTACCTTCGCGGTCTTGAGACATCGACATCATGAT
CTGCGTCTCGTCTTCGTCGATTTCTTCTTCTGACTCCTGCTGGTGGCTATAATTCCGACCATCATCGTCTCCAAACGAGTTCGGCGCGTACACGAACACG
GGCGGCTTGGATCCATCGCCATCGTCTTCGTTCGGCTGCGTCACGAGCTCCGTGACGGCCTCGGTCTGCTTCTGCGTCGCCTGGCTGTCGCGCTGCGTGG
CGTCGTTGTCGANNNNNNNNNNNNNNNNNNNNNNCTCCGCGCTTGCGCTGGAGGGTCGAGTACCACTGCCCGGGCATGTCCTGAAAGCCCTCGGGCGTGT
TTTCCCCCGAGAGTGCGTCGTCGCCCGCAAACACGCCGACGAACTTGGTCGCTTCGCGCGGCATTTTCGCCGAAAATGTTAATGACAAGGCAGTCGCGAC
CAGAGATGTGCTTATCCCTCTGCAAGCAGGTATTAGCTTGGCCAGACAACAGTCTGAACCTCTCCAATAGAATATACAAATACAGAGCGCAAACAAAACT
TGGCAAGTATTGTAAACTATTGTATTGGAAAATCAACTTATGCAAGAGAATAACTTCATGGAAGTTGAAGTCCAGAGTGTTGGTCTCTCCCTTGTTACTG
CAATTGGCGCAAAGATGGCACGGACGCTAGCAGCAGCCCATGGAACTCGTGGCGCTCGTCTCGCGAGCGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCTTCTTGCCCCTCGTGGTCACGATGATCGGCGCGCCGTTGCCTTCGCCATCCTTCTTCCCGAACTCCACCGCCGTGATGTCACTGAATGGCACGACGT
TCGTGGCGCCAGGTTTTCCCGCACTGCGCGGCGACGTGGGCTTCGCGGACGTGATCTTGAGGGCGGCATTCGGGAGATCGACCACCATGCTGTACAAGGA
GCGCGAGCCTGTCCATGATGACTAGATGAAGGAGGCGACAGCAGCATGAGTGGATGCGCGATGCATACAAGAGGAAGAACTGTCCTACCATGTTGATGAG
GTACTCGGTCTTGGGCGGATTCTCCTGTTGTTGCTTCTGCTGCTCGCTCTGTGTAGCATTGATATCATTTGGCGATTGCATGTTAGTAGGTCTTTACGTC
ATCTTGAACAAACAAGGTGGAGGCACGCACCGTTGTCTTGGTAGACTCGGTTAGCGACATCGATTTCAGCGCCTCGAGCGGCTTGATCGACAATGGAGCA
AGCTGCAAGGGTGCTGGTGGCAACGCTGTGGTCGAAGTGACCGACATTTGGGGCGCCTGCACAAGATACACAAAGTGTTTAGGAGTAAAGCAATCAAGGA
GCTATGGGGAGAAGAAAAACAAACGTACTTGCTGGCTTGGAAATGGTGGCGAGCCGGCAAAGGTAACGATACGCGTCGGTGATCCCTGAGTGGCGCTTCT
CTGAAGCAATGGGAATGATGCTAGCGACGCTGTTGTTCCTTGAGATGGTTCGCTTCCAGAAGCCTCGATGTATAGCCCAGCCACCTTGTGTGGGCTTCGT
GGAGCTGGAGACGATGGATTTCCGATCTCAAAAACGAGTGTTTTGGAGATTCCAGCAAAGTCCCTGAGCAGCTTCGCGATGTCGTGCAGACTGAGCTCCC
GGATGTCAACATTGTCGAGCGCAACAAGTCGACTGCTGGTGGGAATGTCGTCTTCTCTCAGCTCACATGATGGCGCATTATCGCTTGCTGGGGAGTATCC
CGAGATCACTGCCTTTTGAGGGAAATGGCTGTCGAACTCAATTCCAAGCGGCGATCGAGTTACGACGACGCTTCTTAAGGTTCGTCCACAGGTATTGCTG
AGCATGTGCGTGTACACCTCCGACGTCGTACTGAATGTGATCATTTTCTCATGCGAAGCCATCATCCGCAGGAGTTGCGTCACCTCGAGCAACTCAAGGG
AAGTTACGTCGAAATTGTCAATTGCAATGATTTCCGATCCTGAGATGACACCTCCATGATCAAAGATCCACGTCGCTCCAGTCGATTGGTCTTGGTTCAA
CCGATCCACAATCACTTTGTTGGAGATGCTGTTCTTCAAGTCGATTCCGAGTGGTCCCGGCGGCACGTGCACATTGATGACTTTCGCGTTGGCATCTTGC
GCGTCATTCTGAAGATAAAAAACGAGTTCTTTGGGAACATCGCTGAGTTTCTTGAGCAAGTCCGTCACTTGGGCCAACGCCAAACACGAAACATTCATTT
TGTTGATGCTGCGCAGAAATGCTCCGATTGGAATGCGCTGGCTGGCCTCGATGGCGCCCGGTTGACCGTCTGGCATGGCATAGAACCCAGAAATGCGCGC
GCAGTCTTGCCTCGCTCCATCAAAGTGGATTCCAAGTGGCCCTTTTGGCACGCAAATGACCTCTAAGGAACGCTGCTTCTTGAGTGCCTCGATCAGTGGC
GCGTTGCACACGATGATATCCTTCTGGGAGTGTTTAAGCTTCGACAGAAATCCCGATATGTCAGCTAAAGTGTGGTAGGCGACGTTCACTTTGTTGATTG
AGATTATGAAGCTTCCAGGAAGGAAAGAGGCGCAGTGCTTGAACACTGGGCGACCGGCGTCAGCCGGAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCTGCGTGGTGAGACTGAGCGCTATCGAGATTGAGGCCAAAGGGTTCTGACTCCAGTCGGATCTGGTGGCACTCTGGCAGCACCCTC
TCCCTGGAACGGTAGAAGTACAGAGTACGGGGAAATGAAGCTGCGTTGACAACTGCAATAGCGTCACGGCGATTCAAACAGGAGACATCCGTTGCATTCA
CTCCGATGAGAATATCGCCTGGCAAAAGCGATGCCTTGATTGCTGGGGTGATCGTGGACGCGACTACGTATTTGAAATTCTCGTTATCGTCGAAGCAAAA
GCCAAGCGGAATGTCAGCAGTAGCATGCTCAGCTTTGACAAAGATTTCGCATGAATTCGGTGTAGCGCGGTACAGAACGATCTCTTTTTCTCGATCCCTC
ATGTTCGACAGGACGGTGATGACCTCTTCGCGGGGCAAGGAAGATACATCGACACCATTCACGTGGATAAGCTGACAGCCACGATGGATCTTTGAATGCT
GTTCCAGTTTCCCCGTTGATCCGTCCGGCAGCTTCTGAAACCCATCGATCATCGCTCTATAATTCAAGGTCTCACTGATCAGTAAGCCGAGTGGTCCAGG
AGGAGCTCGCACGAGAACAAGCTTCTCGACGTCGTACTTCTTCTTGTCGTAGTGCGACGGATGGTACCGAGCGAATGTCAAGAGCCTTTTCTTCGCTGCA
AGTTTTCCGAGACGAGCGCTGACTTCACGGAGACTGCAGTGGACCACATCTTCGCCCTCGATCGCGACCAATCGGTCTCCGATGCTCACCGTTTGATGCA
GGACTCGCATTCGCTTCAGGTCCACTTCGTCCCAATCTCCAGACGCTAAAGAGTCAAAGCCACAAACCACAATGAAGCCCTGGTCGTTCTCTGCAAGCGA
CATGCACAAGCGCCCTGGAGCTGCTTCAACAACGAAATGCTCGCGTCCAAACTCGTCGAGACC