Description :
From Genome Similarity Track
Location :
contig_194:13802- 16984
Sequence
3182 bases(100 bases per row)
TTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACG
CTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGGCGATACCCAGTATCGCCACGACGGCTCCTCGCCG
CGTGCACAGGTGCTGTGCACTCGCGGGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGC
GGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATTAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGC
AGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCT
TCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTT
GCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTA
AAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGA
TACGTCGAGCCAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGC
GCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAG
CGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGC
GCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGT
CGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAG
GAGTAATTTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGAAGCTTTGGTGGTAAATGAGAACTGTATTG
ATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGT
AGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATTGGACCACCCTGTGGTGGTCACCTGAATGTATGCCTTAGTGCATGTTGTACTAAG
GTAGGAGGTGAACCGAATGTGTAGCCCCGCTACACTCCCATTCGTTCAGTTTGACGACTCCTCTTCTTGATTTAGCTCGCCTCGCTGGGTACGACTCGTC
GAATCTCGCGGCAGGCGAATTCGCTGGCCTCGCTGAGATTCGGCGCGTGCTCACCGAACATGAGGAGTCCCAGAAGCAGCGTGACGCCGCGTTGGCCATG
CTCGTTTCTCTCCTTTTGACAAGCGCTCCTCTTCCGATGATGCGTCCTTGCGCCAATCCATCTTGGGCGCTAATTCGCTCGCTGACATACTGTTGGCTGT
GAGACAAGATGTGGTTCCGCTTCCTGACACGGCTAGCGAGGTCGCCGACCTTCGGACTAAGCTCGTCAAGTCCGAGCGAGTCGCTGCCGCCCGCCTCAAG
CGGATGGAGTCCGCTATTGCTGATTCTGCCACCATCCAACATCGGTTGGATACCGCTACGCATGAAACAGCGAAGTGGAGGGCAGCATCGCTGAGGACCA
CTGAACTCGTCGAGTCCTTCAACAAGACCATCCTTCAGCTTAAGGCTCAAGCTAAGGTGGACTTGCAGCTTGAATCCGAGCGAACTCAGGCTGCCGAAAG
GACCATTCAAGGTCTCAACGCCGAGTTAGCTGCTCGAGAACGGACTATCGATCAGCTTGGTCGACAACTCGTCGAAGCGAATGCTGCGCAGACTGTTCTC
CGCGGGGTGGCGACGAAATACATTCGCGACGCGCAGGAGGCTGCCGTCTTGGCGTGTTCGGGTGGTGACTACGCTCTCGCTAACGCTAAGCGCACCATCT
CACGACAGGCTGAGGTGATCTTGAGCCAGAAGGCTGTCATTCGCCACAACGGCCATTATCCGGTGCATTATCCCCACTTGGTGGTTGCTGCACTTGTTGG
AGTTGACGTGCCTGGGCTGGATCCGCGGGATCTTCATCTGAACGCTCGGTTGTGCCGTATCCTCGCTGAGCGCTTCCTAGAGTCGATTGAGCTAGCCGGT
TCGACGAGTCCCAGCGAAATCACTCTCCGGATTCGCCCGGTCAGCTCGTCGATTCAAGCTTCTACCAGTTCGCCGAGCGGGTTTCAGTCTAACTCAGCGG
GTGCTGCCCGGCCGAGCTCAGCGAGTGATTTCCCACCAAGCTCAGCGAGTGCAGCTTCTGGGACTCTATCCGGTCGTTCTCGTTCCACACATTCTCGTCG
CCAGTCGCGTCGTCAAAGTCGTTGTTCGGTCTCCCAGTTGCGGAACGCACCACTCCGCGATCTGACCTCTTCGGAGCGTCTTCGCCGATATGCGAATCCT
GCTTCCCCCACAGCTGCTGGCCCCCGTCGGAGTCGCTCGAAGAGTGTTCCACGTAGTCTCTACAAACGTCCGGTTCCTGAAGAGGGTTTCGACCCTGCCA
CAACTTTGCTCAGTGCTGAGGTGATCGACGAGTTTTCTCCTTCTCTTCCGATCCCTGGTCGGAAGCGCCTCCGAGCCCCGGCCTCCAGTCTGCTCGGGCC
TGGTTCGTTGGTTACCGCCCTCAGCGACCTTCGCTGAGTCCTTCCCAGAGTCCCGTTTCGCCGACAATTATCGATTTGGCAA