Description :
From Genome Similarity Track
Location :
Scaffold_148:13800- 19068
Sequence
5268 bases(100 bases per row)
TTGCCCGACCGTCTTCATAGACAATGTCTCTGACACGCTCTCTGCATCCATTTGTGAGCCCGACGTTCTGCCAAATATTAGATGTGAAATTCACCTCTGC
CCCCATCTGCAAGATATCGGGAGTTATCCAACACCCTGAACTTGTCAAAAGTCATTGACATTGCTAGGGAAGAATTGTTAATCGCCATAATGCGCGTGAT
AGGGTTCCCATTTATTAAACCTTTTTGCATTGTAGCGATTGACTTCAGCATTATCAGCGAAAGTCTCACAGAATCCGTTAAATCCTACCCAAATTCAACC
TCCACTATTTGCCGGTGATCGAGTTATTAGGATCTCCCACTGAGACTTAAATACAACCCCGTCATGACGATTCTTAAATAGACATAGAAATTGAATTTGA
AGATGGCCACTAATATCCTAGTGCTGCCGGACAACCTAATCCAATATAACAACCTTCTTGAAATTTGCATTTGTAATTTCTCCTTGCAAACCAAATGGTT
TATCAGAATGTACATACAAAGGTGTACCACCAACAAAAAGTAATTGTCCTGAATCTCCAACTAGTATCACATTAATACCACCAAAAGACACGTCTTGTCT
TCCCATAGCTTAACGTAATCGACTCTCAATTTTTTCAGCAGGTCTAGACTGACCATAGAGTACTCGTAATTCTCACTATGAGCACTTTGTTGAACCTGTC
TTGAATTTTCTTTATCGATTCTCTCTTAGTTCCACAAAAGATCGAGACACCGCACCAACCGGTATCAAAAATATTGAATGTAAGGTAGGTATATCCACAA
TTTAAAAAATCCTTCAACGTGAAGGATTTACGGATTATATCTTCACGGACAAGTGCGGCGAAATACCACAGATAGTTCGTGACTTGACAATTACCGCCGT
TCTGTTAACAGTAAAGAAGAGTTGATTTTAATTTTGACCAGCTTTACGTAGCATATATAGGCATAACTTCTTATTTCAATTCACATTGTGACGATTAAAC
ACTGGAAGTTCATCATGCCAGAAAGCTGGTGGGTATTTTTGTGTCATAAAAGTCAGCCAAGTTGAAGCATTTGCATATGGAGTCTCGGTATAAAAAAACT
GAAAATGTGCGTGCCACTCATAGTTTGGGTCAACAAATGGTTTATATAGGATCTGTTGGCCATTCTGCAACAAAATTTTAGCTGCAACCATCCACTGCTC
ATGCTCTTCCAGATCATGTTCATATCTTAGTTCTCCCATAGCTCATAATCACCCTACCCCCTGCTTCAACCGGCAATTCACGTATCTCGACATTCTAATG
ACAGTATCTGAACAGATAAGCATCAGCTATTTCTCGGAAATGTTCCGTCCGTCTTCGGCATCATCTTTATTATCCATCTCTTCAAGGTCGTCAAAAGACC
AAGACGAATAATTGATCAAGGAATACTTTTAAAAATATTGTACGTGGGTGATCGCTGCTACCTCCATAACTTGGAAGGGTAACAACGATCGTGCTCTCCG
GTTTATAATGCTTGACCCATTTAGTATTTGATCACAAAATTCTTGCAAGATTCAATGAAGTTAGGCTGTTGCTTCAAGCTCAAATTGGAATATTCCGGAT
AAATCGGTGCACGTTTTGCAAAACGATCCAGCAAGTTGTCCGCAATAATAACCTCTCTGGTAGCCTTATCAATGCGCAGCTGTTAATTGCTGATCTCGGG
GTTGCCTAATCCGAAGTTGTCGATGATTGAAAGTGCTAACAACAGAAAAAAGATCATACTGGAGGTTTCACACCGTACCACGTCCCAAAGATCAACGCAC
GGAATCATAAGAGATCTCAGCTTCGGTACTGCATTATCGGAGTCATGTGCATGTTGCATCACAAACCTGTAGATCTTCTTAGCAAATACCTCCCACTTTG
CTCACCTTGGACGTATAATTAACCATGTAGGCAACACCAGCGTGATGATCAGAAATTAGCTGAGGGTGCACGTTAACTCTCCAATGCTGGTGCATTACCT
GGTGACGCACGTTTAACCATGGACCATTCTTCACGATGCAAATTTAGCTCGCACGGAGGAACCGCCTTCTTTGAAATTTATGCTTGTACCATTTTGATGT
TGAATCGAATAAAAAAAATCGACACCCGGGCGACACATGTGACCCTGACAGCAATTTGAGAGCTCCAGGTAATCAGCATTCAGAGAAGTGGGATTGTATA
GAAATTCTCATCTGTTTTGGGTACAAGACCTTAAACGGCCACCGAATCATCTACAATCGCAACCGTAAATTTATTGTTGTCAAAAGGGTATCAGCGTAGG
TAATAACTCTTTGCTCTGCTGCTTTTCCACGGATTGAAGTTCCCTTTAGTTATTCATAATAATCACGATTGAAGAGAGAAATTTCCCCCATCTGTTCTCA
TCCAACCTTCCACTATAGGCAGTAGCAACCAATCTCGGAATGCCAGGATCATTTTTAAGCTTGACTACACCATGAGCGTGAATCGCGGTTCGATACTGCC
GTCATAGCGGTATTATATCCATCCAGGGTCAAGGAAGTCATAAAAAACGTCGAACAAAAACATCCAAATGAGCAGAAGAGTACCAGCAACCAGATGAGCA
TTTTTGGTAACATTACGAAGGCACCTACTTGGTTCAACAAGCTTACCAGTAATCAGCTTATGAGGGCCCCCCCAGTAATAGTCGGTAAAGCTAAACGTGA
AAATCGAGGTCCCACACCCTCTTTGATAAAAGTTGCTTCCAACTCTTGACGTCGAATATACCAATAGGCGTCGGAGCCAGTAATATATGCAGAATGCAGT
GAGCCTTTCATCAATCAATCCCAGCTGTTGTCGTATATCATTTGCCAAAAATCGTTAATTTGTGCGAGCAGCGTCTCCGATATTTTTCTTTAGGTAAATG
GTAAATTGTGATAACGTTCTTAAGTCCTGTCATTCATCTAGACTTTTAATCGATCATGCTTTGCAAAAGGGTAAAACAGAGATTTCGAGTCAGAGGGTCC
AACTCGGCTAAAAGAAGAAGTTGAGCAATTTCATCAGTCTCGGATACGGTAAACTGACGATCACGTTATTTGGGGTCTGCAAATCCATGAAGAAATAACT
TTATATAAGTCATCACGGCTATTGAGGTTGTATCGAACTCGTGAATTGGATGAGACGCACCATCAGACCATGTGAAAGCGTAATGCCAACGGTTAACTTC
CAGGGGTTCATTACCGGTATCCTAAATGAGGAAGTGATAAGCCACTGCATCTTCTTCGTTAGTAGCGATGGGATTATACCTTTACCAGCTTCCACGATCT
CATCACCTTCAACAAATACTTTAGAGGGTTCTTGTGGTGCGTCCATTTTGGGTAGCAACCTGCAACTCTTCTGGATAGAAGTAATATTTCTCCTAATTAA
TTTCTGGTTAATGATGTACCAGAAGTCTCCTAACCGCTTGTACACGTGCTCGATTGAACTTGAACTCACCAGAAGGGCTGTCCTGGCCACTACATTTCAC
GATGATTATGGGATCTTGTCAGCTAGACGAGGCACTTCATCAATAAACACCGCAGTTTCTTGTCGGAAGCTGGCTATATAACCACCATGGATAATATAAC
CATTCTTGTGCTTGAAATAAACATCACAGGGACAATGGGCGACAACAACATTGTCAGCTTTCTCAACAGGACCTTCACGTGATCAGGTATTAAAGAATCG
TCAGTTATCATGTCATTTTCACATCCAAACTTTTTTTAAGAAATACCTGTAGCAAAACTAAGATACGTATGAGTAAAGAATTTGCGAGTTATATATATTG
CAGTGTAGACTACCTCTCTTGCAGAGGCTGAAAACATAATTCAGAGAAACGTAGATCACGTATGTAGTGGCCGTAATTTAATACAATAGAAAAAATTGAC
CTTGGTTGTACTTACGCATGTCTAAACAGAAAATCGCATTGCTTCACGACATCAAACTTGCTGATGAAAAGGGTCATTTCAAACGCATTAAACTAGTCAA
GGTATTTTAACTTTTAATACAATATCGATAAAAGGTTTGGTTGCAGCGTTTCTGTGTAGTAATCTTCTTGCCCCCTGACTTGTAGTTTTTTCAGATCTCG
CTGATCTTTCGACTCTATATAACGACGACCAGCACAAGCTTTAAAATTGAAGATGAGTAAGGTATTAGCATATGGTGATATAGCAGATACAATAGGTTTG
ATGATATGGACATTAAATAACATAAATGTATCTCGAATATCTTGAGCACGCCTAGCTTGAATTTCATCTTCTGCTCCAAAATTGCGGCATGCGGTGGTTG
CTAAATTGGGACTTCTAGAAAGGTTAAATAACCATTTGACACTTGTGCAAATACATCAATCATTAACATAACTTGACTATCTCGAGCATGTCGATTGTGG
AAATCAGCTTATGTTTTAATCTGGAGGTGAGCGGCGGTTTCCGATTAGTATATTGATAAATATATTATGATATGGCACATGTGCACATACATCAAGCAAT
TACCAAATTTTACTGTTATGAGCATGTCTATCTTGGTATTTATCTTCTCGTACAATATAGAGGCAAGCGGCGGTTTCCGATTAATATATTGAAAACATTG
ATAACGATTTGACACATGTGCTAATACATCAATCAATTACAAACCTTCATTGTTGCGAGCATGTTAAGCCTGGCTTTCAGCTTCTACATCAATATGGCGG
CAGGTGGCGGTTGCTGAATAAGTATATACAAATGGTTTAGCAAAGATTCTAAAAAGTGCAAGTTAATCAAGCAATTACAAACCTCGATTGTTCTGAGCAT
GTCTAGCTTTGTATTTAGATTCTGTATCTATTTGGCGGTGTGAGATGGTTACTTGATAATGTTGAAAATTAGGTATACCGATTAGGGAGAAAAAAGGGTT
GCAGCAACGCATCATTTGCAAGCTCTTGTATTAATCACTATAAATCGAGATTATCGTGAGAAGGGAAAGCTTGCCTTTGAGGTTTTGTTTCCGCTGTGCG
CCTAGCTCTCATACCTGCAAATTTATCGATAAAATAGGGATGAAATAAGTTGTTGTTTATTTGAACATAATCTTAAACATCTATCAGAATAAACGATTTA
ATACACTTTTGACACGGTAATTTTACGATCATTTATTGATATAACCATGATTCATGACATTTCAATATGACTTTAATTTGACTAAACACAATTAATATGT
ATATAAATTTATGGCACGTATGGAGATGAAGACAGTAATTATCAGCTTCTTCCTGCTCTCGTAGAGCA