Description :
From Genome Similarity Track
Location :
Scaffold_2879:1380- 2663
Sequence
1283 bases(100 bases per row)
GGTTTGAGCCTACCAAGGGTGAAGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTGTGGATCTGAGGATGTTGGATCCATGGATCTGCT
AACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGCTTCAGCACATCGAGACGAAAGTGGCGTTTCACCTA
AGCGAGCTCCAGCGTGGGTTTGCCGACGGATCGCTCGATGAAAACGCGATCGAGAACATCGACGAAACTCATTTCGTTGTCGACTTCGACAACGGCAAGA
CGCTTGGGTTTTGTGGCGACGAGACTGTGAAGTATGCTGACGTGGTCTCCGGAGGTGAAGGAATGACGATATTCGTGCGACTCTCAGGAGGCCCAAGCGC
TCGGATTCACCCACCAATGATGATCTTCATGAATTTGGCGGGGAACTATTCTACTCACGGAGTTCCAGACAAGATCCCTGGCCTCTGCTATCGCTCAAGC
AAGAAGGGGTGGATGACTCAAAAGCTGTTTCGTGAGTACCTAAAAGAAAGGAGGGCGAAGAGAGCAGACGTTCATGGGCGCAAGAAGACGTTTCTTTCCT
CGACAACTGCTCCGGCCATTTGGAAGCGGAAGAATATCGTTCAGAGCTCGACGCTATCAGCTCTAACCTCAAGTTCTTTCCGCCCAATACGACGGATTCT
GTGCCAGCCAGCTGACGCGTTCGTCATTTCCAAGATCAAGGACGCGTGGAAAGTCAAGTGGAACGAGAAGAAGATGGAGTTGATCAAGGAGAACGGGTGG
CAAAACAAGGTTCGCAAGGATGGCTCGTGGTCAGGCAAGCTTCAAAACCCAGGTAAGATGTTTTTCTTGCAACTCGCTTCAGATGCGGTCAAGGCGGTCA
ATCTTCAAAGGGATAAGAACGGAATGTCATACGCGCGAAAGGCAATGATGCGATGCGGTCTGTCCCTCGGCATCGACGGGACGTGGTCGGTTTCTCAGCT
TTACCCGCATCTCCAAGACATCATCAAAAAGCACGAGGCCCATTTTGAAGGCGAGCCTGTTGACACGGAAAACGCGTAGAAATACAGCAAGGTGGTCATT
TGATAACATAGATATAAACATTGGAAAGAACGAAAATTTAGTCTTAGTTGGAGCAGTCGTCTGAGCGACGAACCTCCACGCTGAGGTTTGACGGTTCGAG
TCTCACGTTTTGTGTATTTTTTTGTGACCGGTCGAAATTCATAAATAGTCTTAGCACTTAAATAGTCTGTGTCAGACTATTTA