Description :
From Genome Similarity Track
Location :
Scaffold_1657:1380- 2422
Sequence
1042 bases(100 bases per row)
GTGAAAGACATAGAAGGTAGAAATCCAGGCAGGTATAGGCTTAAATATCAATACAGACTTCTATTTGCACGATAACACGCAAGTGCCTTCCTGCCCTCAA
GAACCGGAACTACATTGGCCGTACGAGCTCGGAGAAGGTTGGGAATTGCGAACCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACA
ACCTAGTGAGCTTTTCCTATACACGTGCAGATCCAACAGGTTAACCGAGTTACTACTTGGTCGGTTACACCCTAGAAGATCTCAACTCTCAAGATCCCGT
CACAGGAGGCGGCAAGTACGACACAAAGGACTAACAAAGGCAAGGGAATACACCCGCAAGGCAACCCTACGGCCAGATCTACGATCTAGGCCCCGGATCT
ATAAGCTCGAATATTCGCTTAGGATACGGAACCCTCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACGC
TCAAGCTTCACCACTTGAACTCTTCAGAAATTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGCTCAGCAGAACACGGAT
CATCGGGGGACCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCCAGCAATCTCGCAGATTTTGCTGATCCCGCTACGGCACAATGGTGC
GCGTGCCCGGATCTTTTCGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAGGTCGGATCGACGA
AGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGCGAGGTGGATCCGGATCCGGATCTAGAAGAGAA
ACCTCTCTAGCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACTGCGTCAAGATCCGCTAACAAAACAAGGGAAAATGAAGGCGAAACGGTATG
CATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACC