Description :
From Genome Similarity Track
Location :
Scaffold_1011:138- 7294
Transcript NameFunction/comments
Physo_145315hypothetical protein
Physo_145316reverse transcriptase

Sequence
7156 bases(100 bases per row)
GTGTAACCCTGTTACACCATCCCCCCTCAAGGTTAGATGCGCCGAGTCACGGCACGTCAATAAGGAAATTGACCATTCGTCAATTCTTCACGTTGGGAGA
AAGAAAACTCGAGCTCATTCCGCAATGAGCTCGCCTCAGAAGAAGACCGACGCTGCAGCAGAGGGGAAGTCCTCCGCCGGGATAGAGACTCTCTCTATCC
CCGAGTACCGCGAGCGTCTTAAAGCAAAGCGTGACGCTCTGGCTACCAAGGCTGCGGCGGGGACAACTCAACCAGAGATTGTCCTCGAAGGTTCTTCTGT
AGTCAACGACGCCGTTGACTTCGAGGACGACGACGTGGAGATGGAAGAGGGCGAGGCCTCTTGTAGCAAGCGCAAGGAGTCTATCGACAGCGATAGTCTC
GACCCGCATGCCGGGTCGAAACGCCCTCGTGAAGGAGACGACTCGGACGCTTCGAGCTCGAAGCGTTCGCGCGGCGAGAGCGACACTCCGCTCTCTGCTG
CTGGGGCTTTGAGCTCCCCGCATTAGGTGGCGCCTTCAAGCTCTCCGCGCGCTACTCAGGCAGCGCGCGATCCGTGGATGCCGTCTGCGTCAGAGATCGC
AGACCGTGTGGGCAACACTGTGCCTCCAAACGAAATCCCGCTGTACGTATGCAGCGGTATCCACGACGATGCTGTTGCGGAGGAGCAGCACTGTGATCCG
TTAACGAATCAAAGGCGCGACTACTACATCGGGCTCTTCCACGAGCTCCAGTACTTCTCCAGCAAGAAGACCTCTTCTCGCAGCAAAGTGCCTGAGTGGC
AGGCACTTTGTCAAAGTTGGAATGCTTTTGTTGAGAACTTCAACAAGAAACCGGCTGCTTACCGCGAGCGGGTTTAGCATGCCCGTGAGCGCTTCGAGAC
ATTCTCGACGCGCGGGCGGCTGGAGCAGCTCCACATATCCTCTGTGGACGTTGGTATTCCATGCGCGGTGCCCGAAGGCCAACGGTGCACGTTGTGTCTT
CCGGGTGCGGCGCGCTTGAGCGACCGCGACCTAAACGGGTACACGACGATTCGTGTACCTGCGAGTCTCAGGGATCTCCGTGCCAAGTTCCTGGCACGCG
AGGAACGCGATGATCGCGAAACTTCGGGCGCTGCAGGTAATTACAGCGCTCGCGCTACATTCGCGTCGATAGTGCGTGGTGAGCTTCGTACGCCCTCACC
ATTTCTGGAACGTCCTGCAGCCGGACGTCCCGTGACTCCCATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACCTTGATCCGACGCTCGAGGAGCGGATCGCTGCTGTGGAACAGCATCAGAGCCGGGAGT
TCGCCGCTCTGAACCAGGAGGTGGCGATCCTGAGGGCTGAAGTCGCTCAGGGTTCGCAGACCGCGTCGCACGCTTGGCCCAGCGCGTTCACGCGCTGGAG
CAGAGGTTCGCTCCCGCTGGGGCTTCCGCTTCGGGCCGGCCGAGCTAGGTGGTTCGTGCTGCCGGTACGGCTTCAACCGCCCGACGTAACAGGTCGGATG
GAGGCGCATGCTAGATGGAATGTCTAGCGTGTAGGCGTTGCCATGCCGTGCCAACACCGTGAACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCGCCCCG
AAGTCGGAAACTGCCTGTTTAGGCAGGTTTTGAGTTGCTAACAAAACCAATGAACCCTTCTTGAATCCATTAGTGTTGCCCCTACCAACATTGTCTGCGT
TCAGCTTCTGTCGACCGACGGAAGCTGCAATAGCGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTGCACGAAGTTGATTGCGTCCGAGCTGAACTC
GTTCAGCTCGTTTCTAGCAGTAGGCCCGGCCTCTGCGTTCGTCTTCGCGGTGTCTGTGCCCTGCACAGACCCGTTCTTCTTCTTCTTCTTGCGCGTAGTC
GCGGCTGACACTGTGCAAGTGTCAGCGGCATTCTGCGGCTACTGCGTTGCAGTCGTAGATCCTCCCCCACTTAAGGAAGGAGCCACCATCCCGAGTAGAC
TCGGGAGGCGTGGGTGCCTGATGGCATTCACGCAGAACGGTGTATGCCCGGTCGAGGCATGAACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAGGCA
CTCGCTCCAGTGTTGGAACGAGTGAGCGTAGTTCTTAAGCACGTCTACGAGCACGCGGTTCACGCGCTCGGTTTGCCCGTCCGTCGGCGGATGATCCGCA
GTCGACATCGAAAATTGACTCCCAAGAAGTGTAAACACTTCTTGCCAAAGGTGTGCAGTGAAGCGCGGGTCTCGATCCGACACAATGTCGATCGGCATGC
CATGGTGTTTGAACACCATGTCAACGAACAGACGTGTGGTCTGTTTCGTAGTCACTTCAGCGGGTACCGCAGCAAGATGTACCATCTTGCTGAAGCGGTC
AACAAAGACCACAACGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAACACTCCCGGTGTAATGACTGC
AAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTATACTGGTGGGCCCAGTAGAAGT
CCCGCGTGAGAAGAAGGTATGTCTTCTCATGGCCCGGATGTCCCGCAGTCGGTGCATCGTGATACTCGTACATGATTCTGAGTCGCTGGTCATGGTCATT
GGGCACGACAACGCGGTCCGCGTTGTTGTCGACTGCACTGTAGAGTAATAACCCGCCGTGCACCCGATAACGGTGTGCACGAGCCCGAAGATGCTTCGGC
AGCTTCTGACGAGCTTTGTCAGAACGCGCTGAGCCGTAGGCCAGCAAGAGCTTCGCGTCCGCGTCGTGCGCGAACGCGACCTTCACGTCGTCCAACAGTG
ACGACGTCGGGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGACATCGGTCGTGGCGTAGTCAGGCGACGCGAGAGCGCGTAGGCCACCACATTG
AGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATCTCACCACTCGTTGCGAGATGTGCGGCGACTTCACAGGCGTCC
GCAGCGATGCGTGGTCCGTATAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTGCGTACTTCATGGCAAGGAGCTCCTTGTC
ATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTAGTAGTAGACGACACGATCGCGACCCTCGTGATCGTGCTGCATCAACGCACATCCG
ATTGCGAAGTCGGATGCGTCTCACACAACGTGGAATGGGCGATCTTGGTCGGCCGCCGCCAAGATCGGCGCCTCAGTCAAGCCCCGCTTGACTGCATCCA
AGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCTTTCTTCAGGAGCTGTGACAGCGGGCGTATCATGCCCGCGTAGTCCTTCACGTACTTGCA
CAAGTATGTGGCCAAGCCAAGAATGTAACAGGGTTACACGCACAAGTGGCTACAGTCACTTGTAACTCTAACAGACACGACGTCTGTTAGAGGTTCGAGA
GACTTTCTCGACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGACCACCACGACGGGTGGTGCATAGAGACTTAGGATTCCTATTGGCTGAGAG
CAGCATCTCTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTGGAGGAAGTCA
GAAGCATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGTTCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAA
CTCTAATTTAAACCAAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACAATAGGTCAAAATCAAT
AGAAGGGTGATTTGATTGGATTAAATGTGTACAACCAAGCATATTGCAAGGTTTTAGGACCACCAGCCAGGGGATCCTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCAAGCTATCGA
CTGCCGGAGTCGACGGCGTTACGTCGCCTTGGCTCTTATTATTGGCCAGACCTGATCCAATCAGATTCGCGTCAGCCTCCACGGCTGAGGCGTGTGACTC
GCCTGCGTCATCCGTGCCCCTTGAGGCCGGAGACTCTTCCTGATTCGCTGAAAAGCGGGTGTCGACCTCCGAGGTCAACACATTTCCTTCATTAGCTGTC
GGCGGCAACGCCGACGCTAGCAGCTCTTGCGCGCGTACACGCGCGCGCCCAGGGCGCTCCGGGACAGTGGCATTAGGCGCTGTCTCGAGTGGGGAGTCGC
GCGCACCTGTCGGTGCGTGCGTAGCGGCAACAGGGCCATCGCTCACTGTTCCGCTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCTAATCGATGAC
CGGATCATGCCGGGCAAGCCACGGCATGCCCAATACAATGTCAAACTTATCGTCCAGATCCAGGACGATAAAGGTCTCGACAAACTCTTGATCTTCATAC
GTGAAACGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAGTCCTCGAAGT
CAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCCAGAATCTACCAAAGCACGGAGAGAGCTGCTTGCTCTCATCGAGTTCACGTTCAG
GATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGCGAGAATGAATCTCACTGGGGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGA
ACTGCATTACCAGTAGGGCGCCCCCGCGCCTACTGGCGTCCAGCGTTTTTTGTTTGGTTGCGACGGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGT
GCACGGGGGCCGTGCACTCCCGAGCAAAGTGACCGACTCTACCGCAACGGTAGCATCGCACATTGTTTCCCTGCGACTGCTGGAGTCCAGCAGTTGCAGC
ACTCGAGACGTCAATGGGTTCTGGGCCTCCCGTCCTCACTACCGGGCGTGGCTGTGGCCTCGGCACATGTGCATGCAGCTTAGCCTGCCGCAGGCTAAAC
TCCTCCTGCATTGCAAGGGTAATTGCAGCTGCGAAAGTACTCGGGTACTCACGGAAGAGATAGGTCTTCACAGGCCCATCTCTCAGTCCATTTATGAACG
TGACGACCTTGGTCGCCTCATCGATCGGATTGGTCGCGATGTTCGAGACCAAGTACCGTGCTCTCTGAGCGTAAGCATGAACGTCATGCTTGCCCTGCTG
CAGGTCGAGGAACTCCGCCCTCGACCGGAACTCGTTTTGCGGTGACTCAAACGCTTGTCTGAGCTCCTCCTTGAAACCCTCGTACGTGCTAAAGCACGTA
GGATCCGAGAGTCGGCGTCCATATGCCCAACTTCTAGCACGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGATGATATGTCGAG
CCGCAATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGTTCACCCTCTCTTCCGACATAGTTACTCACATTGAGCTTTAGCGATTGCGCGCGTGG
TGTCGTCCCGGACGACACCGCGGTAGTAGGAGCAACATCGCGTTGCTCCTTCAGGATGAAACCCAGAGCAACACCGTGTTGCTCTGTCGGCGTTAGCGTA
CGCAGCATCATAGCTACAGCCGCCTCACCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGATCCGACAGGTGGGGACAGTCAGCGCGTGCAA
CGTAAGTTGCAGGCGTAGTGGAGCTTTCCATGGGCACCTCTGTATCCATGGGAGGG