Description :
From Genome Similarity Track
Location :
Scaffold_573:138- 3611
Sequence
3473 bases(100 bases per row)
TTTGAGTGATGACGACATTGCCCGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTA
ATAGCAAATACTAGCTTCTCCGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGATCTCATCACTGACTTCACCGAGCGTT
CCTGCTGTCCATTAGCCTGTGGCCTATAGCTCAAAGTCGCTCTTGATCTTGACTGCATCATCTCTGCGAACGCTTGGAACACCTCGCTCATGAAGCGTGG
GTCGCGGTCATGCCGTATTAATGATGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCT
TGACAATAACGAATCCCGTGAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCCTCGAGACGAT
CTGGAAAGGTCGTTCGGCGAGTACGTTGCCAGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTC
TCCACGTCAGCGTACAAGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGT
TCTGCAAGACCTCTTGAATCATCGTTGTCGGTACCACAAGCCGCAGCTTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTTCAATCCAATATAG
TGAAGCACGCCGTCTTCTGACAACACGAACCGGTCAGCGTACTTCCAGGCATCTCGAGCTTCTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTT
CTGATGTTAAACCACTTCTGCTCCTCGTCTTGTGCAACTAGTATTCGTCTGCGTCGCTCCCGCTGTATCGCTACCGGGTCACATCTACCGCATCGGGAAA
TGCCGCTGGTACAGTCTGTGAGGATGGTCTGGCAAATCTTCGCCGACTGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATTCTGCTCTTGAGCCTTTG
AGACATCCTCCGAGTGTTCATCTGCAAACCTGACGCGTTTCTTGGCTTTCGTCTGTCGCCGAGTCATCACTGCCATATTACCATAATCGCACTTTGGTGA
GCTGTAATCAACCACGAAATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCTTGTGACGAAACATCT
ACCGAGTCTTCATCCGGCTCGTAGATCATTTCCTGGATGTGGTTCAGCGATGCCAATTCCGACTTGCGAGATTCAGCCAAGATTACCCGACTGACCTTCG
ATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCCGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGCCGTGAGTTCCTTGTG
AGTATTCAGCAGCGCTAGCAACGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGATGACTAAATCCTTG
GCACCGTGCGCAATAGCAGCCTTGACACCGTTTATCATACCTTTATACTCTGCCTCATTCACCGTGGTAGCTGAGAGGTAAGCGTTTGCAGCAATCACTA
CCTTCCACTCAGGAAGGCTCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGCT
GTAATTACGGGAAAGCCTGGCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCCTTGTGTGGAGGTGCCACCGGCGCGAGCGAGTCTTCCAGG
TCGACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCGAAGGCGACATCCTTCTCCTTCCCGCGCTGCACCTTCAGGTGCCACTGCGATAGCAGCACTG
CGAACTGAACCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGAC
GTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTACG
GGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCC
TGAGGATGGGTGAATGTGAAACACTCGTCTTCAATTTTTCAAAGGAACGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCCTCCTTGAGCTG
GTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTGCTCGTTGGAAAC
GAAAGCTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAAGATGC
TCTTGGTGAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAAT
GTCATCCACAAACGACCGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGATTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGT
AGTACAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTT
CAGCTAAACGCATCCTCTCCGAGTATTCAAACCAACCTCCTTTAGGTTGAACGAACCACCAGAGTGCGTTGTCAATCATACGCTGATAGATCATCGGCGC
GTTCTTTAGCCCGAAGGGCATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACGAACGCCGATACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAG
AAGCCGCTTGCTGCATCCAGCGAGCAGAACCATAGGTAGCGATCGAGATCTGGTAACAGGTAGTCGACTAGCGGCATTGTATATTTTATGATCGCGGTGA
TAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGAC
GATCAGTCCTGCACGCAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATCGCAGCGGCACGCGTCGGGCACGCTGTTTAATTGGGGCGTGCCCC
TGTGTGTCGATATCGCATACCGCTCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCT