Description :
From Genome Similarity Track
Location :
Scaffold_733:138- 3330
Sequence
3192 bases(100 bases per row)
CTGTCCTGGGTCGAAGCTCGTATATCGACGACATCGCCCGCGGTGCGCCTACTTGGGAGCAGCTGTGCCAGGATCTGAACGCGCTGCTCTTCCGACTACG
TTACTGGAATATCTCTGTGAGTCTTCCCAAGAGCGAATTCGGGAAGTTGTCCATTCCGTACCTCTCTCACGAGATTAGTGCTGAGGGCATCCGAGCGACC
CCTAAAATCGCGAAGGGGGTCCAAGACTTGCCGTTCCTGACGACAGTGAAAGGCGTCCAGAGTTTCATGGGGAGTCTGAATTACTACAACAAGTTCATTG
AAGATCTACCCGTGATCGCGGCCGTCCTGTACGAGCTGACTGAGGAACAAGTGAAATCCAGGAGAGACCTATCCCAGGAAGCTTTTGAAATCCTGAAGCG
CAAGATCGTTTCGACTCCGTTGCTCAGACACCCAGATCGTTCAAGGCCCTTCGTGATTATTCTCCACGCGAACCCGTGGGCAGCATCCGCTGTGTTGGGC
CAGGAGTACGACAGGATTGTGCACCCGGTTCGATTCACAGGTCGCGTTTTGAATGACGCTGAGCTGCGGTATCACATTGCGGAAAAGGAGGTGATTGCTA
TCCTAAGAGTCCTGGAGGTGTTTCGCACTTTGGTTGAAGACAACCCTAAGATCGTCGTCTACACGCGATATTCTGTGTTGAAGTGGTTGCTGACCTCGCA
GTCGGCAGACGGTCGAACGGTGAAGTGGGGTCTGAAGTTGTCCCACTGGAACCTGGAGATACGCAGAGTTCAACGGGATGAAGACGACTTGGCTGCAATT
CTGGGTGCGGGTAATACTCCCAGAGAACACTTGGATGAGATCGCTGAGAACCTGATCCCAGCCAAGGGGCGCGTTAAACCTCCAGTGCCTATCAGTATGG
AAATACTGGAAGCAGACTAGTCTGAGCTTCGATGGCGCCGCTAAGACTTCCACGCGACAAGGGAGCTGCGGCTGCATCCTAAGGCATGTCCCCGGGTGGG
AAATCCTGGATGCCCAGGGATTCACCCTGGAGGACGTGATTGTGAACGACGCTGAGTATTATGGACTTCTGAAGGGCCTCACTCTGGCGATTGAGCGTGG
AATTCAGGACATCGTTGTGGGTGGGGACTCCAGGATTGCCATCCAGCAAGCCCAGGGTCTCATCAACTGCAATCAGCCAAATCTCCAGAGGAAGCTGGCT
GAGTATAAAGTGCTGAAGACGAAGTTCAAGTCTGTGCGGCTGGTGCATGTCAAGCGAGAGTTTAACCAGGCCGCAGACTACCTGACGTCTAAGACCCTCG
CGCTTGGTGAATCCTGGAAGGTGGAGGATGCTTACGAACGAACACATCTGCAGTTGGTGTCCAAGATTCACGAGAAGTTGGTAAGACCGAAGGTGTTATT
GAATGGTGGAATTCAGGGGAGTGATTCTCAAGGTGTCGAAACTCTGGGTATCCCTGGACCTGAGTGCGCTCCGTTGCTTGTGGCGGCCAAAGTGTTTGCA
GTAATGACTCGGGCGCGGACTCAGGAGATCGAAGCCCAAAGCGAACCCATGGGACCTCTGGAGTACCAGGCGGAACGCTGGCGACGCATCAAAGTGCACC
AGGACAAAGATGATCACCTGCTGCAACTCAAGGATTTCCTGAAAGGAGACACGACGAAGCTGTCGCACGCTCAAGCCAGGAAACTCGCGAAAGTCGCTGA
TGATTTCGTGTTGGATTCCAGAGAAGTCCTGTACCGCTTGAGTCGGTCCACCAGAGATCGACCCCGAGACATGGTTGACGAACTCAGACTCGTGGTGCCG
AAAGCTCTGCGACCGGATATCCTGCATTACGCTCACGAAGATTTTCAGGGTGGGCACCAGGGGATCACGAAGACGTACGAGAAGCTGTGTTCTGATTTCT
ACTGGCACGCCATGTACGCTGATGTGGACGTTTTCGTCAAAGAGTGTGTGGATTGCGCCAGCGGCAAGGGGCGCCCTCACAATCCAGGGCCTTCCCCTGG
GAACATCGAACCGAGGCGCCCTTTTGAAGTTGTGTCTATGGATTTCGCGACACACTTGCCTAAGTCGGACCGTGGGAACACGTTCCTGCTGCTTTTTCAG
GATGCGTTCTCAGGATTCGTCATGTGTAAACCCATGAGTTCCACCACGGCGCAAGATGTGGCTGAAGTGTACGAAGAGCAGGTCTTCAGGAGATTCGGCG
CGAGCTCGATGCTGAGGCACGACCAAGACCCAAGGTTCATGAGTGAGGTGTTCACGCGCTTCCGTGAACTTTTGGGTAGCAAGCAGCGAGCCACTCTAGC
GTATCGCCCCCAGGCGAACGGACAACAGGAGCGGTCGGTGCAGACTGTCGTGCGCAGCATTCGAGCGTACATTGCGGAGGCGGACCAGAGTGACTGGGAC
GACCATGCTGAGCGCCTGATGTTCGCCCTGAATACATCGATCGATGCAACTCGCCTGGACACTCCGTTTTTTCTGGTGCACGGCTGGGACGCACACGGCA
CGGTGTCTGCAATGTTAAGACCCAGGCCCTCGAGTATCCAGGAGCGCACTGCGTACGAGTGGCGCAGGAAGCTACAGCGTGACAATAGTTATGCACAAGC
TTGCGCTGAGGATCTTCAGAAGAAGGCCAAGCGTGCGCGCTCTGTCGAACAAACCAGGAAGTGGAGAGAGCTGTCCGAACGACTGAAGGCAGGATTCGCA
GCCGGTGATGCTGTGTGGCTGTATATACCCAAAGTGCAGCCCGGGCTGAGCCGCAAACTGGCTCACATGTGGCATGGCCCCTTCAGAATTCAGGAAATCC
ATGACAACTTCCGCGTGAAACTCAGGGTCGAGAACACAAGATATCGCGTGAATCCCTGGGTACACGTGAGCCGTTTGAAACCCAGAGCACTATTCCCGAA
GCGGCCCACTGTGGAGATCGACGTGGACGAGGATGATGACTTTGATGCAGCGCTGTTGCCTGAAGACAGTTGGGAGCCCGACGCTGCGAACGGTGAGTAC
GAAGTTGAGCGAATCCTGGATTTGCGATGGACTAAACGGACTCGGACAGCGAGACGAATTCGTGAGTACCTTGTGAAGTGGAAGGGGTATGATGAGACCG
AGTGGCTGCCTGTGTCGAAGCTCAACTGTGGTGCCCTGCTCTACAAATTCAATCAAGGCGCAAGAGCGCGGGCCCGTTTCCAGGCCATGCAG