Description :
From Genome Similarity Track
Location :
Scaffold_54:138- 1557
Sequence
1419 bases(100 bases per row)
CACCCTATGGCATTGTCAGCCGGATATTGACCAATCATATGCACTTCATTCGTTTGAGTGACATCTAAGTACGGAGAGTGACCGTCACTCCAGCTCGTTG
CTGAGATGGGCTCCAGATGCGCAACTTGCGGATCGCTGGATGCCATGTGCGATACAACCGCCAACACTGTCGTGGGCAGCATCCTGTGTGCGTGACCTCC
AAAGTGGATGCGGTCTTCTAATTAAATGGGTGTGGCCACGCTGGAGTTGCGAAGTGGGCCGCGCGGACGCGTGAATTCGTtGGGTTCAGACGGTCGACGT
CTGCCTGGGAACGCCACTTCACGACGATCGTCCCACTTCCGCACCCATGTGAAAAGGGgTCGGGgTACGGTGGGATAGCCAGTGAACACGAGAGAGTCGA
CACTTGAAGCTTTTTCTGTCTACAACAGTATTGTTTTAGAACGAAACTGAGTCAGCAACGACGCGGTTTGACGGCTGAGTCTGAGACTGAGGACGACTTC
AACAGCTTGAGCCGCCATGCACCTTATAAGGACAGTATGGGAGACCTGCGCGAATGAGAACGAGGGGTTTTGCCCCCATACGAGGCGGCCACGAGGAAGC
GTATGTGCGAGGAAAGCCAAGCCACTGACAACAGATCAACTGTAGATGAACGCCGAGAACGAAGCCCAATGCGACGGCAGAGAGAACGCTCGGCGCGATG
AGCACAAGAAGAGAGAACACGAGAAGAACGTCGTCAGGAATTCGAGAGCGTCTAGATGCAGAACCACCAGACACAGAAGAACGATGATGTCTTCTATCTA
CACTGGTGTCCATATACGCTTCAAAATCCAGCTAGACGTGTCTGTAGTTAGCTGCGACCCTGACAAGTTGCACGTTTTTCAGCCTGCGACTCCACCATAC
AGCATCAGAGTGAAGTATCACAGTGTTCCTTATCACTCTACTCTGATGCATGCTCTGAGGGATCAAGAGGTCTTCTACCAGTAGATGTGTGTCGATACTG
AACACCCATCGAGTAATCAGTCCAAGTCGATACTGTAGATAATAGAGTGGCGTAAGCTTGTCTCTCAAACTTGAAGAAGAAGgAAGACTGAGTCAGAGAC
CAAGCCAAAGAACGACTGCTTCCCGCTCGCCGGGTCTTTGTCGTGGCTACTGCTCAGCCGTCTAGGCTATGAGCAGATAGAACGCATCAAGCGCCGGAAA
AACCTCCAATGGTCTATGCTTCGATCTCCAACAACGCATGCCGTCGGCATGGACGCTGCTCTTGGACGTGCGTGTCAGACCGGTAAGGCGCGAATCTCTC
CCACAGACGCGGCCTTCCTTTCCTGCACCGGTACTCATACCCCCACTGTAAGACGCCGAGATGGAACTTCGTGCAGgTCGGGGACTGCTATCCGAATTcG
TCCATTGTACATCTCGCCA