Description :
From Genome Similarity Track
Location :
Scaffold_1019:138- 1550
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1019-snap-gene-0.3Phospholipase D, Pi-PLD-like-1

Sequence
1412 bases(100 bases per row)
CcAGCCAGAACTCAACGCTACCGCTTGGTtCCTGACCGAGGCGGAGATCACATcGTCCCGTgtCGAGGTGCCTCGTgAtGGgCTCGCGGTTTATTCCATt
GgAAACACTGTCAAGACGTTCGCTGCTAGCAACGAGtaCTTCTCATCGGCGTACTCTGATATCCGTGCGActGATGCGAATGATAGCATCTACCTCACCG
GATGGAGCGTGGACAACGTGCCGTTCGATCCTATGAACGATAGAACAGGAGCCGTCAGCGGACTtCAGGCTTCTTTGGCAGTGCcGTCATCCGAGGaGTC
GACgTTCGcGCGATTGTGTGGCAAAATATTCTCGagCGCAAGCAGAATCTCCGAGTCCGCGACTACTTGAACAACGCGATTCCAAAGCCGATCAAGGCCG
GACCAGCACGACTCATCTTTGACGACCGACTACCTTCCGTGAGCGCGTCGCACCACCAGAAAACgCTGATCGTTCGCAAGCAAAACgaTCTtGTTGCCTA
CctaGGtGGaGtcGACTTGACATCGGATCGATGGGACACGATGTACCATAACAACGCTCAGCTCCGACGGGATGCCAAGATCTCGCGCAATTTTGACGGT
TGGTTGGATGCGCACATGCGCATCGAAGGCCCTGCCAGTCTCGATGTTGGTGCCAATTTCTTGGCTCGCTGGAACTCGCGCAAGAAGCCGTCCATGGATC
ATCTTGATGACCTTCTTGATTtCGACAATCCACCATACAGCGAGCTTCCAGCCTTTAATcTCAACCCAactGCGAACGGCACGCATAGCATCCAAATCAC
CCGCACATTCAGCTGCAAGTACCGCAAGTACTTTGAGTACGCACCTCGTGGCGAGCGCTCGCTGTTCCATGCcAGGTTGAAAGCCATCCGTCAGGCTAAG
AACTTCATCTACATCGAAGATCAGTACTTTATCTTTGTGCCtGAGCTTCTGAATGCGCTATTGGAAGTTCTTCCTCGTCTCCAGCGTCTCATCGTCGTGG
TGCAACGCCCAATCAAGGAGACTAAACTGACAGGTTACGAGAAGTACCTTTTCGATATGGTTGCCCCAATTCAGCAGAAGTATCCGAACAAGTTTCAGCT
GTACACGACCAAGAAGGCACGCaCCcTATACATTCACAGCAAGCTCGTGATTATCGATGATGTCTTCCTCTCcGTGGGGTCAGCAAaCTGGAaCCGCCGC
AGTATGACGTCAGATTCGGAGATTGGCGCCAACGTCATTGACCAGGAGCTTGTTGTCGcGCCAGAAGGCGTGTTGGTGACCAAGCTGGCGAGAGATCTCC
GTGTCCGCAAGTTCATGGAGCTCACGGGCAAAACCTaCGGTGAGATCGATCAGCTCCCACTCGTGGAAGCTGCCAACCTCCTTGaCGCCTCTGCGGCCGA
TCCAACAACGAT