Description :
From Genome Similarity Track
Location :
Scaffold_3027:138- 1450
Sequence
1312 bases(100 bases per row)
GAATCAAAGTTTTGCTGTACGAAGCAGTTCCCGCTATTACTCCGCTAAGGTAGCCCATCCTGTACCGCTCGGAGTACTCACCGCTGTCAGCGGAATGTCG
CTCGCTCTCATGAGCAATTGGTAGTAGCCATCGACCAAGTCGAGCGCGCTGTACAACGTACAGCCTACCATGTTGCTCTGCAGAACATCCTTGCGAGGAA
TCATCGTTTGCGCCGGGATAGTGGCCGCATTTAGCTTGTTAAAAGCATGAACAATGCGCCACTTGCCGTTCGGCTTTCTGACACAGAACGTGGGGGTCGA
GTGCGGAGACTTACTCTCACGCACCATCCCTGCCTCGTGCTTCGCACGGAAGAATGCGTCAATGACGTCACACTGCTCTCTCGGCAAAGGCCATTGCCTT
GTTACGCAGTATTTGGTTCCAGGAACCAGGTCAATCTCATGACACACGCCTCGATCCGGAGGCAGGCCCGTCGGTGGGTCTTTTGAGACAACGTCTCCAT
ACTCCTTCACCACCGGGTAGAAGGGATCCGAAGGATCTTTGAGGATCGCCGATCCGCTTCTTGCGCTCAGCGCCTTCTTGGTGTCCTCTAGGACCGCATC
GTCCACGACGGATGAGGAGTTCAACTCCTCCTCAGGTCCCAGCAAGACCACCTCGGCTAGCTCGCCTGCCTTTAAGGCTTCGCCGAACTCGGCAATGGAC
ATCTCGTCCAGCTCTAGCAGAGCATCTGCAGCGGGCAGAGTATCAAGGCTGATATCGCCTTCTACCTCCCCCGTCACTCCGTTCACGAGTGTATACAGCT
GTTCACAGCAATCACGTGGAGCATCACCGCTCGTCACGTTGGACACATCGTCCGACGTCGAAGACGTCACAGACGCCCTGCGTCTTCTTCTCCTCTCCCT
CCGCGACCGAGCCCGGCCGGATGAGGGCGGTGTGGCGACATCTCCGTCACCACCACCGGGTGCAGCAGCACCATCACTCCTCGAAGAGATACAGTGTCTC
GCAAGACACTCGGCTGAAAGCCAAGAGGTTCTTGACCTTCACACAGTGAACTAGGTGTCACTTCACCTGCATCTCCTGGAATGCTATCACCGCAATCATG
GAGTATGCAATGCCGCTAGTCGACGACCTGTTAACAGATCTCGAGCGCTACCTATGGTTCTGCTCGCTGGATGCAGCAAGCGGCTTCTGGGCGGTCATGA
TGACCTTGCGAGCGCGTAATGTCAGCGTTCGTCTGCGCACTAGGAAATTTTGAGTGGTTACGCATGCCCTTTGGGTTAAAGAACGCGCCGATGATTAACC
AGCGTATGATTG