Description :
From Genome Similarity Track
Location :
contig_6:137974- 139879
Transcript NameFunction/comments
g2066.t1ETK77692.1 hypothetical protein L915_16086 [Phytophthora parasitica

Sequence
1905 bases(100 bases per row)
GGCTGGGACGTTGCCGAGTGGCGCGACATCATCACTCGGATCCAGGAGATCGCCATGGAGGAGAACGACGGCATCCCGATGGTGTACGGCATCGACACCG
TGCACGGCGCTGGTTTCGTGCTCAACTCGACAATGTTTGGTGCCCAGCTCAATGGCGCCGCCACGTTCAACCCCGACCTCGTTTACGAAATGGGTCGCAT
CGGCGCCCAGGACACGCGTGCTGCCGGCATCCCCTGGGTCTTTGGTCCTATCCTCGAGATCGCCAGCAACCCGCTGTGGCCCCGCACCTACGAGACGTTC
GGTGAGGACCCACACCTTGTGTCGGTGATGGCGGACGCCGTTGTCCGAGGTCTTCAGAGCGACAACCAGACAGCGGCGTGCATGAAGCACTTCGTGGCCT
ACTCTAAGACAAATACTGGTCTTGATCAAGACGGCGTCACGATCTCGGACTTCGACTTGCTGAACTACTTTGTGCGGCCATTCCAGGCTGCTATCAACGC
TGGCGCACTCACGACGATGGAGAACTACATCTCCATCAACGGCATCCCCGTGATCGGTAACCACCGTATCCTGGAAGTCCTTCTTCGTGAGGACCTTGCG
TACGACGGTATGGCTGTGAGCGACTTTGGTGAGATCGGTTCGATGAACAACTTCCATCGCGTGGCTCGTGACGCTAACGAGGCCGTTCGTTTCTCGTACA
CTCACACGGGTATTGATATGAGCATGGGCTACGACACGACGTACCTGAACGGTACGAAGCTTCTGATTGAAGAGAGCCCCGAGTACTTTGACCGCCTCAA
AGATTCGGCTCGCCGCATCATCAAGCTGAAACTTCAGCTGGGTCTGTATGACAACCCGATGCCTGGTGCCGATGACGTTGCCCTTGTCCGCAATGACGAC
GACGTCCAAAAGTCTCTCGACATGGCCCGTGAATCCATCGTGCTGCTGCAGAACAACGACAGCACGCTGCCTATCTCGAGCTCGTCTTCTGTGTTCCTGA
CGGGCCACTCCGCCGACAACATCGGCAACCAGTGCGGTGGATGGAGCGTCAGCTGGCACGGATACACCGGTAACGACAACTTCCCGAATGGCATCTCCGT
TAAGGAGGCCATGGACGACATTGCTGGTGATAAGGTGACCTACTTCAACGGTCTCGCCTCGGACGGTAACTACTCCGATGCCAACATGACCACGGCCAAG
CAGTACGCCAGCCAGGCTGACTACACGATTGCGGTCATTGGTGAGCACCCGTACGCCGAGAAAACCGGAGACCTCAACGATCTGGCACTTCCCGCCGGTC
AGATTGAATACGTCAAGGAGCTTGCGTCGACGGGCGCCAAGGTGATTGTCGTTCTGTTCGGGGGCCGACCGCGTCTGCTAGGAGACCTCCCGGAGAATGT
GTACGCTGTAGTGAACGGATTGCTGGCCTGTGAGCAGGGCGGCAAGGCGATGGCTGAAATCCTCTACGGACAAGTGAACCCGAGTGGTCGTATGCCAATC
ACTTACCCGAAGGACCCCGCCAACATCATGATCCCGTACAACCACCGCGTTTCCACTGAGTGTGCGGACTCGAACTACTGCGAAATGCAATGGGACTTCG
GCACGGGACTCAGCTACACCAGCTTCACCTACTCCGACCTCACGCTCAGCAAGACCAACGTCACGTCCAGTTCCGACTCCATCGACGTGTCTGTGGTGGT
GACGAACTCTGGCAGTATGGCAGGCAAAGAGACGGTGATGCTGTTCCTGACGCAGCCGTACCGCTCGATTTCGGTGCCTGAGGTGAAGCAGCTCAAGAAG
TTCTCGAAGGTCAGTCTGGAGGCGGGTGAGTCACAAACGGTGTCGTTCACGCTGACGGCAGACGACTGGAGCGTGTACTACCCGCAGATCGGCAACGGCT
TTAAG