Description :
From Genome Similarity Track
Location :
scaffold_37:13796- 14944
Transcript NameFunction/comments
Pl_111479hypothetical protein PHYSODRAFT_313163

Sequence
1148 bases(100 bases per row)
ATGGTGCTGTCTGTGAAGAAGACGCTGGCGCTGGCGCTGTGTGTGTCGACGTTCGCCGCCTCGGAGGTGGCTCAGACCGCGGCCTTGCGCACGCACCCGC
GCCGGGGATTGGCGGGCATCCACCACACGACCAAGTACGCGCCTAAGGTGGTGGAGCAGCCCAAGGGCGCGCCTGACCAGGAGCAAGACGCTGGTAACTC
CGACTCGTACGACTCGTACGACTCGTACGACTCGTACGACCTGGACGGATCGGATTCGGCCGACGTGGAGCTGCAGGGCTCAGAGGAACTGGACATCTCG
AGCTCGCAGGACTTGGACCTGGACCTGGACGGCTCGGCCGACGTGGACGTGGATCTGGACGACGGAGAGGACCTGGACTACAGCGGCGAGGGTGACCAGA
CGTTGGACCTTTCGTCCTCGGGCGACCTGGACTTCTCTGCCGACGCCAGTCTGGACGCCAGTGGGCAGATGGACACAGACATTGAGTTCACGGACGGCTC
TGTGGATCTGGATCTGGACGATGACGAGGATTACAGCCAGGAGCTCGAATTCGAAGATGACGAGGTCGTAGACGAGGTCATCGACGTACCTGAGGGTGCC
CGATCAATCCACCTGCGCGTGCACAACGGAAACGTGGACCTTGACATCATCAAGGGAGCTAAGATGCACGCTAAGAGTGAAAACCAACCTGAGCAGAAGG
AAGAGGCACCCAAGGAGGAGGAGCAGAAGAAGGAGGAGCCGGCCGCTGCTACTGAGACAAAGGAGGAGACTGTTTCCTACGCTGCTGAGGCCAAGGAATG
GATCGAGGAGAACGGCAGCAAGCCCGCTGTCCTGGGCGGCATGATCGGTGCTGCTGTGGGCATTGTGGGTATTGCCGGTGTGGCTATTGCCAAGAGCCGT
AAGCGCACGTCCGAGAAGTCCGTTCTGGCTGAGGATGAAGCTGCTGACGCTGAGGCTGAGGCCGAGGTGGACGAGGACGCCGAGTCGGCGTCGGACAGCG
ACGAGGACAGCGACGAGGACGTTGAGGCTGGTGTGACGGCACTCACGGAAGACGCCGAGGAGAAGAAGACGAGCGTTGTGGAAGGTTCGGTGTAAGTCTG
CAGATAGCAGACGTTGAATGGAGCGAGTAACGAATCGTGTCCAATAGC